Synthetic Gene DataBase
 

Synthetic Gene 6


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID66
GenBank AccessionE00229
GenBank GI2168521
Gene NameSomatotropin (PST)pst*
Gene Length (bp)576576
SpeciesSus scrofaEscherichia coli
StrainsAR68 AND BL21(DE3)
CDSatgttcccagccatgcccttgtccagcctatttgccaacgccgtgctccgggcccagcac
ctgcaccaactggctgctgacacctacaaggagtttgagcgcgcctacatcccggaggga
cagaggtactccatccagaacgcccaagctgccttctgcttctcggagacgatcccggcc
cccacgggcaaggacgaggcccagcagagatcggacgtggagctgctgcgcttctcgctg
ctgctcatccagtcgtggctcgggcccgtgcagttcctcagcagggtcttcaccaacagc
ttggtgtttggcacctcagaccgcgtctacgagaagctgaaggacctggaggagggcatc
caggccctgatgcgggagctggaggatggcagcccccgggcaggccagatcctcaagcaa
acctacgacaaatttgacacaaacttgcgcagtgatgacgcgctgcttaagaactacggg
ctgctctcctgcttcaagaaggacctgcacaaggctgagacatacctgcgggtcatgaag
tgtcgccgcttcgtggagagcagctgtgcctcctag
atgttcccggctatgccgctgtcttctctgttcgctaacgctgtgctccgggcccagcac
ctgcaccaactggctgctgacacctacaaggagtttgagcgcgcctacatcccggaggga
cagaggtactccatccagaacgcccaagctgccttctgcttctcggagacgatcccggcc
cccacgggcaaggacgaggcccagcagagatcggacgtggagctgctgcgcttctcgctg
ctgctcatccagtcgtggctcgggcccgtgcagttcctcagcagggtcttcaccaacagc
ttggtgtttggcacctcagaccgcgtctacgagaagctgaaggacctggaggagggcatc
caggccctgatgcgggagctggaggatggcagcccccgggcaggccagatcctcaagcaa
acctacgacaaatttgacacaaacttgcgcagtgatgacgcgctgcttaagaactacggg
ctgctctcctgcttcaagaaggacctgcacaaggctgagacatacctgcgggtcatgaag
tgtcgccgcttcgtggagagcagctgtgcctcctag
5' End
3' End
Notes
Expression VectorpJLA503, pET3a, pJW2
Assay MethodsSDS-PAGE/densitometric scanning
ResultsNo significant effects when initiation is optimized. However, where low level synthesis of recombinant PST (rPST) is achieved, codon usage in the 5'-coding sequence is important in determining the level of PST synthesis.
Protein FunctionHormone precusor
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding Method10 of the first 14 codons were optimized for E. coli using Sharp and Li criteria (1986).
Specifically: CCA3CCG, GCC4GCT, CCC6CCG,TTG7CTG, TCC8TCT, AGC9TCT,CTA10CTG, TTT11TTC, GCC12GCT,
GCC14GCT
Publication Author(s)Wang, H.; O'Mahony, D. J.; McConnell, D. J.; Qi, S. Z.
Corresponding Author
Corresponding AddressDepartment of Genetics, Trinity College, Dublin, Ireland.
Publication Year1993
Publication TitleOptimization of the synthesis of porcine somatotropin in Escherichia coli
AbstractWe report on the influence of choice of promoter and RNA polymerase, 5'-untranslated regions and ribosome binding sites, codon usage, leader peptide coding sequences and poly A tail in the 3'-untranslated region on the synthesis of porcine somatotropin (PST) in Escherichia coli. A total of 12 different constructs were tested in this study for the production of porcine somatotropin (PST) in E. coli. Several factors have significant effects on PST synthesis. In the presence of a strong promoter and a strong ribosome binding site, the next most important factor seems to be the combination of sequences at the 5'-end of the mRNA including both the 5'-untranslated region and the start of the coding sequence. Codon usage in the 5'-coding sequence per se is not important in determining the level of PST synthesis where high level expression is achieved from a strong ribosome binding site. However, where low level synthesis of recombinant PST (rPST) is achieved, codon usage in the 5'-coding sequence is important in determining the level of PST synthesis. Leader sequences dramatically reduce the level of PST synthesis. The presence of a poly A tail in the 3'-untranslated region has no significant effect on PST synthesis.
JournalAppl Microbiol Biotechnol. 39(3): 324-8.
Summary
CommentsCoding Sequence from nt 10-582
Discussion
PubMed ID7763714
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site