Synthetic Gene DataBase
 

Synthetic Gene 61


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID5461
GenBank AccessionAY911262AY904041
GenBank GI6054916361189848
Gene NameNS2hNS2
Gene Length (bp)375375
SpeciesHuman respiratory syncytial virusHomo sapiens
StrainsATCC VR-26, subtype A293T cells
CDSatggacacaacccacaatgataccacaccacaaagactgatgatcacagacatgagaccg
ttgtcacttgagactacaataacatcactaaccagagacatcataacacacagatttata
tacttaataaatcatgaatgcatagtgagaaaacttgatgaaagacaggccacatttaca
ttcctggtcaactatgaaatgaaactattgcacaaagtaggaagcactaaatataaaaaa
tatactgaatacaacacaaaatatggcactttccctatgccgatattcatcaatcatgat
gggttcttagaatgcattggcattaagcctacaaagcatactcccataatatacaagtat
gatctcaatccatga
atggacaccacccacaacgacaccactccacagcggctgatgatcaccgacatgcggcca
ctgtccctggagaccaccatcacctccctgacccgcgacatcatcacccaccggttcatc
tacctgatcaaccacgagtgcatcgtgcggaagctggacgagcggcaggccaccttcacc
ttcctggtgaactacgagatgaagctgctgcacaaagtcggcagcaccaagtacaagaag
tacactgagtacaacaccaaatacggcaccttcccaatgcccatcttcatcaaccacgac
ggcttcctggagtgcatcggcatcaagcccacaaagcacactcccatcatctacaaatac
gacctcaacccttga
5' End
3' End
NotesNon-structural protein 2
Expression VectorpcDNA5pcDNA5
Assay MethodsWestern blotWestern blot
ResultsUndetectableSignificant expression compared with the natural gene
Protein FunctionA non-stractural protein that mediates inhibition of Stat2 expression
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe sequence was humanized with redundant codons more frequently used in mammalian genes.
Publication Author(s)Lo, MS; Brazas, RM, Holtzman, MJ.
Corresponding AuthorMichael J. Holtzman
Corresponding AddressDepartment of Medicine, Washington University School of Medicine, Campus Box 8052, 660 South Euclid Avenue, St. Louis, MO 63110, USA.
Publication Year2005
Publication TitleRespiratory syncytial virus nonstructural proteins NS1 and NS2 mediate inhibition of Stat2 expression and alpha/beta interferon responsiveness.
AbstractRespiratory syncytial virus (RSV) subverts the antiviral interferon (IFN) response, but the mechanism for this evasion was unclear. Here we show that RSV preferentially inhibits IFN-alpha/beta signaling by expression of viral NS1 and NS2. Thus, RSV infection or expression of recombinant NS1 and NS2 in epithelial host cells causes a marked decrease in Stat2 levels and the consequent downstream IFN-alpha/beta response. Similarly, NS1/NS2-deficient RSV no longer decreases Stat2 levels or IFN responsiveness. RSV infection decreased human but not mouse Stat2 levels, so this mechanism of IFN antagonism may contribute to viral host range, as well as immune subversion.
JournalJ Virol.. 79(14): 9315-9.
SummaryThe natural NS proteins could not be expressed in human cells presumably due to high AT. Synthetic genes were constructed by optimizing the codon usage with mammalian preferred codons and significant expression was obtained for both proteins.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=509
PubMed ID15994826
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site