Synthetic Gene DataBase
 

Synthetic Gene 62


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID5562
GenBank AccessionK03455AY936877
GenBank GI190638261197037
Gene Namegaggag
Gene Length (bp)15031509
Specieshuman immunodeficiency virus (HIV1)Homo sapiens
StrainsType 1EBV-transformed lymphoblastoid cell line (BLCL) B157
CDSatgggtgcgagagcgtcagtattaagcgggggagaattagatcgatgggaaaaaattcgg
ttaaggccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggag
ctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaata
ctgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataat
acagtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagct
ttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagct
gacacaggacacagcaatcaggtcagccaaaattaccctatagtgcagaacatccagggg
caaatggtacatcaggccatatcacctagaactttaaatgcatgggtaaaagtagtagaa
gagaaggctttcagcccagaagtgatacccatgttttcagcattatcagaaggagccacc
ccacaagatttaaacaccatgctaaacacagtggggggacatcaagcagccatgcaaatg
ttaaaagagaccatcaatgaggaagctgcagaatgggatagagtgcatccagtgcatgca
gggcctattgcaccaggccagatgagagaaccaaggggaagtgacatagcaggaactact
agtacccttcaggaacaaataggatggatgacaaataatccacctatcccagtaggagaa
atttataaaagatggataatcctgggattaaataaaatagtaagaatgtatagccctacc
agcattctggacataagacaaggaccaaaggaaccctttagagactatgtagaccggttc
tataaaactctaagagccgagcaagcttcacaggaggtaaaaaattggatgacagaaacc
ttgttggtccaaaatgcgaacccagattgtaagactattttaaaagcattgggaccagcg
gctacactagaagaaatgatgacagcatgtcagggagtaggaggacccggccataaggca
agagttttggctgaagcaatgagccaagtaacaaattcagctaccataatgatgcagaga
ggcaattttaggaaccaaagaaagattgttaagtgtttcaattgtggcaaagaagggcac
acagccagaaattgcagggcccctaggaaaaagggctgttggaaatgtggaaaggaagga
caccaaatgaaagattgtactgagagacaggctaattttttagggaagatctggccttcc
tacaagggaaggccagggaattttcttcagagcagaccagagccaacagccccaccagaa
gagagcttcaggtctggggtagagacaacaactccccctcagaagcaggagccgatagac
aaggaactgtatcctttaacttccctcaggtcactctttggcaacgacccctcgtcacaa
taa
atgggcgccagagccagcgtgctgtctggcggcgagctggacagatgggagaagatcagg
ctgagacctggcggcaagaagaagtacaagctgaagcacattgtgtgggccagcagagag
ctggagagattcgccgtgaaccctggcctgctggagaccagcgagggctgtagacagatc
ctgggccagctgcagcctagcctgcagaccggcagcgaggagctgagaagcctgtacaac
accgtggccaccctgtactgtgtgcaccagaagatcgaggtgaaggacaccaaggaggcc
ctggacaagatcgaggaggagcagaacaagtccaagaagaaggcccagcaggccgctgcc
gacaccggcaacagcagccaggtgtcccagaactaccccatcgtgcagaacctgcagggc
cagatggtgcaccaggccatcagccctagaaccctgaacgcctgggtgaaggtggtggag
gagaaggccttcagccctgaggtgatccctatgttcagcgccctgagcgagggcgccacc
cctcaggacctgaacaccatgctgaacacagtgggcggccaccaggccgccatgcagatg
ctgaaggagaccatcaacgaggaggccgccgagtgggacagactgcaccctgtgcacgct
ggccctatcgcccctggccagatgagagagcctaggggcagcgacatcgccggcaccaca
agcaccctgcaggaacagatcggctggatgaccaacaacccccctatccctgtgggcgaa
atctacaagcggtggatcatcctgggcctgaacaagattgtgcggatgtacagccctacc
agcatcctggacatcagacagggccccaaggagcccttcagagactacgtggaccggttc
tacaagaccctgagagccgagcaggccagccaggaagtgaagaactggatgaccgagacc
ctgctggtgcagaacgccaaccctgactgcaagaccatcctgaaggccctgggccctgcc
gccaccctggaggagatgatgaccgcctgccagggagtgggcggacctggccacaaggcc
agagtgctggccgaggccatgagccaggtgaccaacagcgccaccatcatgatgcagagg
ggcaacttcaggaaccagcgcaagaccgtgaagtgcttcaactgcggcaaggagggccac
atcgccaagaactgcagagcccccagaaagaagggctgctggaagtgtggaaaagaggga
caccagatgaaggactgcaccgagaggcaggccaacttcctgggcaagatttggcctagc
cacaagggcagacccggcaacttcctgcagagcaggcctgagcctaccgcccctcctgag
gagagcttcagattcggcgaggagaccaccacccctagccagaagcaggagcccatcgac
aaggagctgtaccctctggccagcctgagatccctgttcggcaacgaccctagcagccaa
gatctttag
5' End
3' End
NotesNo natural gag gene information was given, so HXB2 gag gene sequence was given as reference
Expression VectorNApEGFP-N1
Assay MethodsNAFluorescence dection
ResultsNot reportedNot reported
Protein Functionantigen
Recoding PurposeTo improve expression
Synthesized ByGeneArt
Recoding MethodCodon optimized for human. Done by GeneArt
Publication Author(s)van Baalen CA, Kwa D, Verschuren EJ, Reedijk ML, Boon AC, de Mutsert G, Rimmelzwaan GF, Osterhaus AD, Gruters RA.
Corresponding AuthorAlbert D.M.E. Osterhaus
Corresponding AddressDepartment of Virology, Erasmus MC, University Medical Center and Postgraduate School of Molecular Medicine, Rotterdam, The Netherlands.
Publication Year2005
Publication TitleFluorescent antigen-transfected target cell cytotoxic T lymphocyte assay for ex vivo detection of antigen-specific cell-mediated cytotoxicity.
AbstractEx vivo detection of virus-specific cytotoxic T lymphocyte (CTL) responses is limited to the use of methods assessing cytokine production, degranulation, or perforin contents of antigen-specific CD8+ T cells. Generally, their cytotoxic activity is detectable only after cultivation. We describe the fluorescent antigentransfected target cellCTL (FATT-CTL) assay, which measures antigen-specific cytotoxicity ex vivo. Target cells were generated by nucleofection with DNA vectors encoding antigengreen fluorescent protein (GFP) fusion proteins. After coculture at various effector : target (E : T) cell ratios, viable and dead GFP-positive cells were quantified by flow cytometry, and antigen-specific target-cell elimination was calculated. The assay was validated with human immunodeficiency virus (HIV) and influenza virusspecific CTL clones and revealed cytotoxicity at lower E : T cell ratios than standard 51Cr-release assays. Moreover, antigen-specific cytotoxicity was detected ex vivo within 1 day in peripheral blood mononuclear cells from HIV-infected individuals. The FATT-CTL assay provides a versatile tool that will advance our understanding of cell-mediated immunity.
JournalJ Infect Dis.. 192(7): 1183-90.
SummaryFour HIV1 genes were codon optimized for human (by GeneArt) and conjugated with GFP to act as markers in ex vivo dection of virus-specific cytotoxic T lymphocyte (CTL) response. They appeared to work well as expected.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=513
PubMed ID16136460
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site