Synthetic Gene DataBase
 

Synthetic Gene 65


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID5765
GenBank AccessionBD086203
GenBank GI22631813
Gene NameDerp 1recProDer p1
Gene Length (bp)909909
SpeciesDermatophagoides pteronyssinusHomo sapiens
StrainsCHO cells
CDScgtccatcatcgatcaaaacttttgaagaatacaaaaaagccttcaacaaaagttatgct
accttcgaagatgaagaagctgcccgtaaaaactttttggaatcagtaaaatatgttcaa
tcaaatggaggtgccatcaaccatttgtccgatttgtcgttggatgaattcaaaaaccga
tttttgatgagtgcagaagcttttgaacacctcaaaactcaattcgatttgaatgctgaa
actaacgcctgcagtatcaatggaaatgctccagctgaaatcgatttgcgacaaatgcga
actgtcactcccattcgtatgcaaggaggctgtggttcatgttgggctttctctggtgtt
gccgcaactgaatcagcttatttggcttaccgtaatcaatcattggatcttgctgaacaa
gaattagtcgattgtgcttcccaacacggttgtcatggtgataccattccacgtggtatt
gaatacatccaacataatggtgtcgtccaagaaagctactatcgatacgttgcacgagaa
caatcatgccgacgaccaaatgcacaacgtttcggtatctcaaactattgccaaatttac
ccaccaaatgtaaacaaaattcgtgaagctttggctcaaacccacagcgctattgccgtc
attattggcatcaaagatttagacgcattccgtcattatgatggccgaacaatcattcaa
cgcgataatggttaccaaccaaactatcacgctgtcaacattgttggttacagtaacgca
caaggtgtcgattattggatcgtacgaaacagttgggataccaattggggtgataatggt
tacggttattttgctgccaacatcgatttgatgatgattgaagaatatccatatgttgtc
attctctaa
cggccgagctccattaagaccttcgaggaatacaagaaagccttcaacaagagctatgcc
accttcgaggacgaggaggccgcgcgcaagaacttcctggaaagcgtgaaatacctgcag
agcaacggcggggctataaatcacctgtccgacctgtctttagacgagttcaagaaccgg
ttcctgatgagcgccgaggctttcgaacaccttaagacccagtttgatctcaacgcggag
accaacgcctgcagtatcaacggcaatgcccccgctgagattgatctgcgccagatgagg
accgtgactcccatccgcatgcaaggcggctgcgggtcttgttgggccttttcaggcgtg
gccgcgacagagtcggcatacctcgcgtatcggaatcagagcctggacctcgctgagcag
gagctcgttgactgcgcctcccaacacggatgtcatggggatacgattcccagacctatc
gaatacatccagcataatggcgtcgtgcaggaaagctattaccgatacgtagctagggag
cagtcctgccgccgtcctaacgcacagcgcttcggcatttccaattattgccagatctac
ccccctaatgccaacaagatcagggaggccctggcgcagacgcacagcgccatcgctgtc
atcatcggaatcaaggatctggacgcattccggcactatgacgggcgcacaatcatccag
cgcgacaacggatctcagccaaactaccacgcggtcaacatcgtgggttcatcgaacgcc
cagggggtggactactggatcgtgagaaacagttgggacactaactggggcgacaacggc
tacggctacttcgccgccaacatcgacctgatgatgatcgaggagtacccgtacgtggtg
atcctgtaa
5' End
3' End
Notes
Expression VectorpNIV4853pNIV4845
Assay MethodsSDS-PAGE, Western Blot, ELISA,Glycan analysis, Enzymatic AssaysSDS-PAGE, Western Blot, ELISA,Glycan analysis, Enzymatic Assays
ResultsUndetectable.Significant increase
Protein Function
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodA synthetic gene encoding ProDer p 1 was designed on the basic of the codon usage frequently found
in highly expressed human genes. Genesynthesis was accomplished from a set of 14 utually priming
overlapping oligonucleotides and after two runs of polumerase chain reaction.
Publication Author(s)Massaer, M.; Mazzu, P.; Haumont, M.; Magi, M.; Daminet, V.; Bollen, A.; Jacquet, A.
Corresponding AuthorDr Alain Jacquet
Corresponding AddressDepartment of Applied Genetics, Institut de Biologie et de Medecine Moleculaires, Universite Libre de Bruxelles, Gosselies, Belgium.
Publication Year2001
Publication TitleHigh-level expression in mammalian cells of recombinant house dust mite allergen ProDer p 1 with optimized codon usage
AbstractBACKGROUND: The major house dust mite allergen Der p 1 is associated with allergic diseases such as asthma. Production of recombinant Der p 1 was previously attempted, but with limited success. The present study describes the expression of recombinant (rec) ProDer p 1, a recombinant precursor form of Der p 1, in CHO cells. METHODS: As optimization of the codon usage may allow successful overexpression of protein in mammalian cells, a synthetic gene encoding ProDer p 1 was designed on the basis of the codon usage frequently found in highly expressed human genes. Gene synthesis was accomplished from a set of 14 mutually priming overlapping oligonucleotides and after two runs of polymerase chain reaction. RESULTS: COS cells transiently transfected with the synthetic ProDer p 1 gene produced up to 5--10 times as much ProDer p 1 compared with the expression level obtained after transfection with the authentic gene. To stably express the recombinant allergen, CHO-K1 cells were transfected with the ProDer p 1 synthetic gene, and one amplified recombinant clone produced up to 30 mg of recProDer p 1 per liter in the culture medium before purification. recProDer p 1 was secreted as an enzymatically inactive single-chain molecule presenting three glycosylated immunoreactive forms of 41, 38 and 36 kD. When examined with respect to direct binding, recProDer p 1 and natural Der p 1 displayed very similar IgE reactivities. However, IgE inhibition and histamine release assays showed a much higher reactivity to natural Der p 1 compared to recProDer p 1. CONCLUSIONS: These data indicated that codon optimization represents an attractive strategy for high-level production of allergen in mammalian cells.
JournalInt Arch Allergy Immunol. 125(1): 32-43.
SummaryTo get high-level expression of recombinant house dust mite allergen ProDer p1 in mammalian cells, a synthetic gene ( codon-optimized ProDer p1 ) was designed on the basic of the codon usage frequently found in highly expressed human genes. As expected, experiments results indicate that codon optimization is beneficial to induce high-level expression of recProDer p 1 in mammalian cells . However, recProDer p1 displayed much lower IgE reactivity than does the natural Der p1.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=663
PubMed ID11385286
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site