Synthetic Gene DataBase
 

Synthetic Gene 7


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID77
GenBank AccessionV00810
GenBank GI52139
Gene NameImmunoglobulin kappa chain (17-1A)mutant IG kappa chain
Gene Length (bp)732648
SpeciesMus musculusSaccharomyces cerevisiae
StrainsF762
CDSatgcatcagaccagcatgggcatcaagatggaatcacagactctggtcttcatatccata
ctgctctggttatatggagctgatgggaacattgtaatgacccaatctcccaaatccatg
tccatgtcagtaggagagagggtcaccttgacctgcaaggccagtgagaatgtggttact
tatgtttcttggtatcaacagaaaccagagcagtctcctaaactgctgatatatggggca
tccaaccggtacactggggtcccggatcgcttcacaggcagtggatctgcaacagatttc
actctgaccatcagcagtgtgcaggctgaagaccttgcagattatcactgtggacagggt
tacagctatccgtacacgttcggaggggggaccaagctggaaataaaacgggctgatgct
gcaccaactgtatccatcttcccaccatccagtgagcagttaacatctggaggtgcctca
gtcgtgtgcttcttgaacaacttctaccccaaagacatcaatgtcaagtggaacattgat
ggcagtgaacgacaaaatggcgtcctgaacagttggactgatcaggacagcaaagacagc
acctacagcatgagcagcaccctcacgttgaccaaggacgagtatgaacgacataacagc
tatacctgtgaggccactcacaagacatcaacttcacccattgtcaagagcttcaacagg
aatgagtgttag
5' End
3' End
NotesNo information on the wild-type gene was given. The V00810 in GenBank was given for reference. There are two "n" at 189 and 264 in the orginal record.No sequence reported in the paper. Authors were emailed on 09/07/05 and no reply yet as of today.
Expression VectorNApLS4 (derived from mYSK)
Assay MethodsWestern botWestern blot
ResultsModerate expression>5 fold increase in synthesis rate and 50-fold increase in the steady state level of protein.
Protein FunctionAntibody
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding Method115 of 215 codons were replaced with yeast-preferred codons defined in Ikemura 1982. Only the
optimal codons (most frequently used) were used for each amino acid.
Publication Author(s)Kotula, L.; Curtis, P. J.
Corresponding AuthorPeter J. Curtis
Corresponding AddressWistar Institute of Anatomy and Biology, Philadelphia, PA 19104.
Publication Year1991
Publication TitleEvaluation of foreign gene codon optimization in yeast: expression of a mouse IG kappa chain
AbstractWe have optimized the codons in an immunoglobulin kappa chain gene to those preferred in the yeast Saccharomyces cerevisiae. The mutant and wild type kappa chain genes were each fused with a synthetic invertase signal peptide that also contained only yeast-preferred codons, and expressed in the F762 yeast strain. The use of yeast-preferred codons resulted in a more than 5-fold increase in the rate of synthesis and at least a 50-fold increase in the steady state level of protein.
JournalBiotechnology (N Y). 9(12): 1386-9.
SummaryThe mouse IG kappa chain gene was codon optimized for expression in S. cerevisiae. A full optimization method was used and the protein was successfully over-expressed.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=526
PubMed ID1367771
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site