Synthetic Gene DataBase
 

Synthetic Gene 70


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID5870
GenBank AccessionX05343
GenBank GI63071
Gene Nameavdartificial avd
Gene Length (bp)459462
SpeciesGallus gallusOryza sativa
Strains
CDSatggtgcacgcaacctccccgctgctgctgctgctgctgctcagcctggctctggtggct
cccggcctctctgccagaaagtgctcgctgactgggaaatggaccaacgatctgggctcc
aacatgaccatcggggctgtgaacagcagaggtgaattcacaggcacctacatcacagcc
gtaacagccacatcaaatgagatcaaagagtcaccactgcatgggacacaaaacaccatc
aacaagaggacccagcccacctttggcttcaccgtcaattggaagttttcagagtccacc
actgtcttcacgggccagtgcttcatagacaggaatgggaaggaggtcctgaagaccatg
tggctgctgcggtcaagtgttaatgacattggtgatgactggaaagctaccagggtcggc
atcaacatcttcactcgcctgcgcacacagaaggagtga
atggctaacaagcacctcagcctgtccttgttcctcgtgcttctcggcctgtcagcctcg
ctagcgtctggacaggccaggaagtgctccctcaccggcaagtggacgaatgacctgggt
agcaacatgaccattggcgctgtgaactctcgcggagagttcactgggacatacattacc
gcagtcacggcgacttcaaacgaaatcaaagagtcgccattgcacggcacccagaataca
atcaacaagcgtacgcagccgaccttcgggtttactgtgaattggaagttctccgagagt
acaaccgtcttcacgggccaatgctttatcgatcgaaatggtaaagaagttctcaagacg
atgtggcttctacgcagctccgtgaacgacataggcgatgactggaaagccactcgggta
ggaatcaacatcttcacaagactgaggacccagaaggagtga
5' End
3' End
NotesThere is no record of a wild type gene, but for mature avidin the information from GenBank is given instead.
Expression VectorpIG121Hm
Assay MethodsSDS-PAGE, Western blot, ELISA
ResultsSignificant protein increase (761-2604ppm)
Protein FunctionBinds biotin, prevents carboxylase reactions
Recoding PurposeTo improve expression
Synthesized ByEspec Oligo Service and authors
Recoding MethodAlpha amylase singal sequence added at N-terminal end. GluB-1 promoter fused and all other codons
optimized to rice.
Publication Author(s)Yoza, K.; Imamura, T.; Kramer, K. J.; Morgan, T. D.; Nakamura, S.; Akiyama, K.; Kawasaki, S.; Takaiwa, F.; Ohtsubo, K.
Corresponding AuthorKoh-ichi Yoza
Corresponding AddressNational Food Research Institute.
Publication Year2005
Publication TitleAvidin Expressed in Transgenic Rice Confers Resistance to the Stored-Product Insect Pests Tribolium confusum and Sitotroga cerealella
AbstractRice (Oryza sativa var. Nipponbare) was transformed with an artificial avidin gene. The features of this construct are as follows: (1) a signal peptide sequence derived from barley alpha amylase was added at the N-terminal region, (2) codon usage of the gene was optimized for rice, and (3) the gene was driven by rice glutelin GluB-1, an endosperm-specific promoter. Avidin was produced in the grain of the transgenic rice but not in the leaves. The concentration of avidin in the kernels was about 1,800 ppm. All larvae of the confused flour beetle (Tribolium confusum) and Angoumois grain moth (Sitotroga cerealella) died when fed transgenic avidin rice powder or kernels, respectively, whereas most of the test insects developed into adults when they were fed a nontransgenic rice control diet. Avidin extracted from the transgenic rice kernel lost most biotin-binding activity after 5 min heating at 95 degrees C.
JournalBiosci Biotechnol Biochem. 69(5): 966-71.
SummaryRice (Oryza sativa) was transformed with a recoded version of avidin gene from chickens (Gallus gallus) in order to increase production of avidin protein. Basically, every codon was replaced by a synonymous codon preferred by rice highly expressed gene. Avidin transformed rice had high yields of the protein. The codon optimization in avidin gene appeared to work well.
CommentsThere is no specific Accession number or name for the recoded gene given.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=532
PubMed ID15914917
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site