Synthetic Gene DataBase
 

Synthetic Gene 71


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID6271
GenBank Accession
GenBank GI
Gene NameNeurofibromin, Human Type 1GST-NF1
Gene Length (bp)10051005
SpeciesHomo sapiensEscherichia coli
StrainsBL21
CDSacacttgcagaaacagtattggctgatcggtttgagagattggtggaactggtcacaatg
atgggtgatcaaggagaactccctatagcgatggctctggccaatgtggttccttgttct
cagtgggatgaactagctcgagttctggttactctgtttgattctcggcatttactctac
caactgctctggaacatgttttctaaagaagtagaattggcagactccatgcagactctc
ttccgaggcaacagcttggccagtaaaataatgacattctgtttcaaggtatatggtgct
acctatctacaaaaactcctggatcctttattacgaattgtgatcacatcctctgattgg
caacatgttagctttgaagtggatcctaccaggttagaaccatcagagagccttgaggaa
aaccagcggaacctccttcagatgactgaaaagttcttccatgccatcatcagttcctcc
tcagaattcccccctcaacttcgaagtgtgtgccactgtttataccaggtggttagccag
cgtttccctcagaacagcatcggtgcagtaggaagtgccatgttcctcagatttatcaat
cctgccattgtctcaccgtatgaagcagggattttagataaaaagccaccacctagaatc
gaaaggggcttgaagttaatgtcaaagatacttcagagtattgccaatcatgttctcttc
acaaaagaagaacatatgcggcctttcaatgattttgtgaaaagcaactttgatgcagca
cgcaggtttttccttgatatagcatctgattgtcctacaagtgatgcagtaaatcatagt
ctttccttcataagtgacggcaatgtgcttgctttacatcgtctactctggaacaatcag
gagaaaattgggcagtatctttccagcaacagggatcataaagctgttggaagacgacct
tttgataagatggcaacacttcttgcatacctgggtcctccagag
actctggctgaaactgttctggcggaccgtttcgaacgtctggttgaactggttactatg
atgggcgaccagggtgagctgccgatcgcaatggcactggctaacgtagttccatgctct
cagtgggacgaactggcgcgcgttctggtaactctgttcgactcccgtcacctgctgtac
cagctgctgtggaacatgttctctaaggaagttgaactggcagactccatgcagaccctg
ttccgtggtaactctctggcttctaaaatcatgactttctgcttcaaagtttacggtgca
acttacctgcagaaactgctggacccgctgctgcgtatcgttatcacctcttctgattgg
cagcacgtttcttttgaggttgacccgactcgtctggaaccgtccgaatctctggaagag
aaccagcgtaacctgctgcagatgaccgaaaaattcttccacgcgatcatctcttcctct
tccgagttcccgccgcagctgcgttctgtatgccactgcctgtaccaggttgtatcccag
cgttttccgcagaactctatcggcgcggttggctctgcaatgttcctgcgtttcatcaac
ccggctatcgtatctccgtacgaagcaggtatcctggacaagaaaccgccgccacgcatc
gaacgtggcctgaaactgatgtctaaaattctgcagtctattgcgaaccacgtactgttc
accaaagaagagcacatgcgtccgttcaacgacttcgttaaatctaactttgacgctgct
cgccgttttttcctggatatcgcttctgattgtccgaccagcgacgctgtaaaccactcc
ctgtcctttatttctgacggcaacgtactggcgctgcatcgcctgctgtggaacaaccag
gaaaaaattggccagtacctgtcttctaaccgtgaccacaaagctgttggtcgtcgtccg
ttcgataaaatggcgactctgctggcttatctgggcccgccggaa
5' End
3' End
NotesCoding sequence obtained using OCR (optical character recognition) software.Coding sequenced obtained using OCR (optical character recognition) software
Expression VectorpGEX-2T (Pharmacia)pGEX-2T (Pharmacia)
Assay Methodsglutathione agarose column, SDS-PAGEglutathione agarose column, SDS-PAGE
Results~5% total soluble protein in E. coli BL213x improvement in protein expression level. Purified protein yield improved from 5.9 mg to 18.2 mg (5% to 15% total soluble protein).
Protein Functioncatalyzes RAS inactivation (tumor suppressor gene)
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodRecoding of sequence was done by a Visual Basic program. Codons with RSCU values lower than 0.2 were
replaced with more optimal codons.
Publication Author(s)Hale, R. S.; Thompson, G.
Corresponding Author
Corresponding AddressBiomolecular Structure Unit, GlaxoWellcome R & D, Stevenage, United Kingdom.
Publication Year1998
Publication TitleCodon optimization of the gene encoding a domain from human type 1 neurofibromin protein results in a threefold improvement in expression level in Escherichia coli
AbstractAn internal domain from the human type 1 neurofibromin has previously been expressed in Escherichia coli as a fusion with gluthathione S-transferase (GST). The expression level of this protein was lower than expected and so a gene was constructed using the distribution of codons found in highly expressed E. coli proteins. Codons were assigned using a Microsoft Visual Basic computer program to give a distribution similar to those found in genes which are highly expressed in E. coli. The optimized gene was then cloned back into the same GST fusion plasmid and it was found that the expression of soluble protein had increased threefold.
JournalProtein Expr Purif. 12(2): 185-8.
SummaryThis paper studies the effect of codon optimization on Human Type 1 Neurofibromin. The gene was expressed in E. coli with a glutathione S-transferase (GST) fusion but protein levels were low. Human neurofibromin is a tumor suppressor gene that encodes enzyme involved in GTPase activity and RAS inactivation. A very straightforward approach was used to improve the level of protein expression. Problematic codons in the wild-type neurofibromin sequence were identified using RSCU (relative synonymous codon usage) values for highly expressed E. coli genes. Codons with a RSCU lower than 0.2 were replaced with more optimal codons. The authors wrote a Visual Basic program to recode the entire sequence accordingly. The program tries to model natural E. coli genes and using different optimized codons for the same amino acid. This is applicable because neurofibromin has several long runs of the same amino acid. Both the wild-type and the recoded neurofibromin GST fusions were introduced into E. coli BL21 with using the pGEX-2T plasmid. After harvesting and purifying the neurofibromin protein product with a glutathione agarose column, the authors found an increase from 5% to 15% total soluble protein with recoding. This improvement in protein expression is relatively effective and simple compared to some other optimization techniques used with E. coli.
Comments
Discussion
PubMed ID9518459
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site