Synthetic Gene DataBase
 

Synthetic Gene 72


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID6372
GenBank AccessionAJ248287
GenBank GI24414907
Gene NamePPATPPAT
Gene Length (bp)471471
SpeciesPyrococcus abyssiEscherichia coli
StrainsOrsayBL21(DE3)
CDSatgatgaagttcaagaaagttgtcgttggtggaacgtttgacaggcttcacctggggcac
aaagcactgttgaggaaggccttcgaagttgggaagatagtttacattggcctaacatcc
gatgatatggtaaagaacaagccctatgccgagaagattcttccctatgaaaggaggctc
aaggacttaatcgagttcttggaggtcaacaattttagaaggtacaggataataaagata
aacaacgcgataggcttcacgactaggataagatcgcttgaggctatagtcgttagtgag
gaaacgtacaaaggagcactattggtcaatagggcaagagaagaagttggcctaagaccc
ctcgagataatagtcattccgattatcaagagcaagttaggggataagataagttcctcc
ttgatcagggccggccttatagaccctttcgggaacccaataaaaagagag
atgatgaaattcaaaaaagtggtggtgggcggcacctttgatcgtctgcatctgggtcat
aaagcgctgctgcgcaaagcgtttgaagtgggcaaaatcgtgtatattggcctgaccagc
gatgatatggtcaaaaacaaaccgtacgcggaaaaaatcctgccgtatgaacgtcgtctg
aaagatctgatcgaattcctggaagtgaacaactttcgccgctaccgcatcatcaaaatc
aacaacgcgatcggctttaccacccgtattcgtagcctggaagcgattgtggttagcgaa
gaaacctataaaggtgcgctgctggttaatcgtgcgcgtgaagaagttggtctgcgtccg
ctggaaattattgtgatcccgatcatcaaaagcaaactgggcgataaaattagcagcagc
ctgattcgtgcgggtctgattgatccgtttggcaacccgattaaacgtgaa
5' Endcagccatatgatgaaattcaaaaaagtgg
3' Endtcgcggatcctcattcacgtttaatcgg
Notes
Expression VectorNot reportedpET28a/PPAT
Assay MethodsWestern blotWestern blot
ResultsWhen cloned in E. coli, this PPAT gene resulted in no production of PPAT, due to high frequency of rare codons. When tRNA molecules for these rare codons were added to the medium, the amount of PPAT protein produced rose slightly, but still was an insigniOptimized P. abyssi PPAT was produced in high concentration.
Protein FunctionCatalyzes CoA biosynthesis
Recoding PurposeTo improve expression
Synthesized ByPCR
Recoding MethodThe codon optimization was performed in software GeneOptimizer by GENEART.
Publication Author(s)Nalezkova, M.; de Groot, A.; Graf, M.; Gans, P.; Blanchard, L.
Corresponding AuthorLaurence Blanchard
Corresponding AddressLaboratoire de Resonance Magnetique Nucleaire, Institut de Biologie Structurale Jean-Pierre Ebel (CEA-CNRS-UJF), UMR 5075, 41 rue Jules Horowitz, 38027 Grenoble cedex 1, France.
Publication Year2005
Publication TitleOverexpression and purification of Pyrococcus abyssi phosphopantetheine adenylyltransferase from an optimized synthetic gene for NMR studies
AbstractPhosphopantetheine adenylyltransferase (PPAT) is an essential enzyme that catalyses a rate-limiting step in coenzyme A (CoA) biosynthesis in all organisms. This study was conducted to obtain a high amount of pure, soluble, and stable PPAT from the hyperthermophilic archaeon Pyrococcus abyssi with the aim of investigating its structural characterization by NMR. Production of this enzyme from its natural gene in the Escherichia coli classical expression strain (BL21(DE3)) was not possible, most likely due to the presence of a high number of E. coli rare codons. Only a low amount of P. abyssi PPAT was previously obtained in two E. coli strains encoding tRNAs that recognize these rare E. coli codons and only by using a very rich growth medium. It was not possible to use this strategy to prepare labelled samples for the NMR study, thus another solution had to be found. Therefore, a synthetic gene encoding P. abyssi PPAT was constructed for which not only the rare codons were changed but which was also optimized to avoid other expression-limiting factors such as internal ribosome entry sites, RNA secondary structures, and DNA repeats. Gene optimization strongly increased the yield of P. abyssi PPAT in E. coli BL21(DE3) and allowed us to start the structural characterization of the enzyme. Circular dichroism and 2D NMR experiments indicate the presence of a well-ordered structure for P. abyssi PPAT and also confirm the existence of this enzyme as a monomer in solution.
JournalProtein Expr Purif. 39(2): 296-306.
SummaryThe point of this experiment was to create a high concentration of P. abyssi PPAT enzyme using minimal media, so that the protein structure may be analyzed, which had not been previously performed for an Archaea such as P. abyssi. The P. abyssi PPAT enzyme was optimized for expression in E. coli, then inserted into the BL21(DE3) strain via an pET28a/PPAT expression vector. The strain was grown on minimal medium. The optimized gene yielded high concentration of P. abyssi PPAT.
CommentsThe gene was recoded because the wild type gene gave very loy yield of PPAT when inserted into the E. coli genome, likely because of the high frequency of rare codons found in the WT gene. The recoding was performed using a set of 23 oligonucleotides as a basis. The software used was GeneOptimizer from GENEART. The results of the experiment are consistent with the expectations given. The optimized gene gave a much higher yield of P. abyssi PPAT in E. coli than the WT gene did. The paper was very informative, not leaving out many details. However, the recoded gene was not entered in GenBank, so no accession number could be provided.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?p=669#669
PubMed ID15642482
Submitter NameBeck, Tyler
Submitter AddressUMBC, 1000 Hilltop Cr., Baltimore, Maryland 21250, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site