Synthetic Gene DataBase
 

Synthetic Gene 74


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID6474
GenBank AccessionXO4436
GenBank GI40769
Gene NameCTTETANGCTTETANG
Gene Length (bp)13591359
SpeciesClostridium tetaniEscherichia coli
StrainsN/AMM294
CDSatgaaaaatctggattgttgggttgataatgaagaagatatagatgttatattaaaaaag
agtacaattttaaatttagatattaataatgatattatatcagatatatctgggtttaat
tcatctgtaataacatatccagatgctcaattggtgcccggaataaatggcaaagcaata
catttagtaaacaatgaatcttctgaagttatagtgcataaagctatggatattgaatat
aatgatatgtttaataattttaccgttagcttttggttgagggttcctaaagtatctgct
agtcatttagaacaatatggcacaaatgagtattcaataattagctctatgaaaaaacat
agtctatcaataggatctggttggagtgtatcacttaaaggtaataacttaatatggact
ttaaaagattccgcgggagaacttagacaaataacttttagggatttacctgataaattt
aatgcttatttagcaaataaatgggtttttataactattactaatgatagattatcttct
gctaatttgtatataaatggagtacttatgggaagtgcagaaattactggtttaggagct
attagagaggataataatataacattaaaactagatagatgtaataataataatcaatac
gtttctattgataaatttaggatattttgcaaagcattaaatccaaaagagattgaaaaa
ttatacacaagttatttatctataacctttttaagagacttctggggaaaccctttacga
tatgatacagaatattatttaataccagtagcttctagttctaaagatgttgaattgaaa
aatataacagattatatgtatttgacaaatgcgccatcgtatactaacggaaaattgaat
atatattatagaaggttatataatggactaaaatttattataaaaagatatacacctaat
aatgaaatagattcttttgttaaatcaggtgattttattaaattatatgtatcatataac
aataatgagcacattgtaggttatccgaaagatggaaatgcctttaataatcttgataga
attctaagagtaggttataatgccccaggtatccctctttataaaaaaatggaagcagta
aaattgcgtgatttaaaaacctattctgtacaacttaaattatatgatgataaaaatgca
tctttaggactagtaggtacccataatggtcaaataggcaacgatccaaatagggatata
ttaattgcaagcaactggtactttaatcatttaaaagataaaattttaggatgtgattgg
tactttgtacctacagatgaaggatggacaaatgattaa
atgaaaaaccttgattgttgggtcgacaacgaagaagacatcgatgttatcctgaaaaag
tctaccattctgaacttggacaacaacaacgatattatctccgacatctctggtttcaac
tcctctgttatcacatatccagatgctcaattggtgccgggcatcaacggcaaagctatc
cacctggttaacaacgaatcttctgaagttatcgtgcacaaggccatggacatcgaatac
aacgacatgttcaacaacttcaccgttgacttctggctgcgcgttccgaaagtttctgct
tcccacctggaacagtacggcactaatgagtactccatcatcagctctatgaagaaacac
tccctgtccatcggctctggttggtctgtttccctgaagggtaacaacctgatctggact
ctgaaagactccgcgggcgaagttcgtcagatcactttccgcgacctgccggacaagttc
aacgcgtacctggctaacaaatgggttttcatcactatcactaacgatcgtctgtcttct
gctaacctgtacatcaacggcgttctgatgggctccgctgaaatcactggtctgggcgct
atccgtgaggacaacaacatcactcttaagctggaccgttgcaacaacaacaacgagtac
gtatccatcgacaagttccgtatcttctgcaaagcactgaacccgaaagagatcgaaaaa
ctgtataccagctacctgtctatcaccttcctgcgtgacttctggggtaacccgctgcgt
tacgacaccgaatattacctgatcccggtagcttctagctctaaagacgttcagctgaaa
aacatcactgactacatgtacctgaccaacgcgccgtcctacactaacggtaaactgaac
atctactaccgacgtctgtacaacggcctgaaattcatcatcaaacgctacactccgaac
aacgaaatcgattctttcgttaaatctggtgacttcatcaaactgtacgtttcttacaac
aacaacgaacacatcgttggttacccgaaagacggtaacgctttcaacaacctggacaga
attctgcgtgttggttacaacgctccgggtatcccgctgtacaaaaaaatggaagctgtt
aaactgcgtgacctgaaaacctactctgttcagctgaaactgtacgacgacaaaaacgct
tctctgggtctggttggtacccacaacggtcagatcggtaacgacccgaaccgtgacatc
ctgatcgcttctaactggtacttcaaccacctgaaagacaaaatcctgggttgcgactgg
tacttcgttccgaccgatgaaggttggaccaacgactaa
5' End
3' End
Notes
Expression VectorN/ApIFGtac124A
Assay MethodsN/ANorthern Blot
ResultsNo experiment was performed using the wild type gene. Previous experiments show that Tetanus toxin fragment C had been expressed in E. coli at 3-4% cell protein.The recoded gene vector, pIFGtac124A, yielded a much higher concentration of protein than the wild type gene, 30-35% of total cell protein.
Protein FunctionIs a fragment protein of Tetanus toxin (fragment C)
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe recoding method was not provided in the paper, although data was provided in Table 1 pertaining
to the utilization of codons in E. coli.
Publication Author(s)Makoff, A. J.; Oxer, M. D.; Romanos, M. A.; Fairweather, N. F.; Ballantine, S.
Corresponding AuthorA. J. Makoff
Corresponding AddressDepartment of Molecular Biology, Wellcome Biotech, Beckenham, Kent, UK.
Publication Year1989
Publication TitleExpression of tetanus toxin fragment C in E. coli: high level expression by removing rare codons
AbstractTetanus toxin fragment C had been previously expressed in Escherichia coli at 3-4% cell protein. The codon bias for tetanus toxin in Clostridium tetani is very different from that of highly expressed homologous genes in E. coli, resulting in the presence of many rare E. coli codons in the sequence encoding fragment C. We have replaced the coding sequence by sequence optimized for codon usage in E. coli, and show that the expression of fragment C is increased. Although the level of mRNA also increased this appeared to be a secondary consequence of more efficient translation. Complete sequence replacement increased expression to approximately 11-14% cell protein but only after the promoter strength had been improved.
JournalNucleic Acids Res. 17(24): 10191-202.
SummaryThe goal of this experiment was to increase the production of tetanus toxin fragment C, which shows considerable promise as a subunit vaccine against tetanus. The C. tetani CTTETANG gene was recoded to optimize expression in E. coli, then cloned into an expression vector, pIFGtac124A, which was placed in MM294 strain E. coli. The cultures were then submitted to Northern blot analysis. The optimized gene was expressed in a much greater amount than the wild type gene (a 10-fold increase in production of protein).
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?p=655#655
PubMed ID2690015
Submitter NameBeck, Tyler
Submitter AddressUMBC, 1000 Hilltop Cr., Baltimore, Maryland 21250, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site