Synthetic Gene DataBase
 

Synthetic Gene 75


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID6775
GenBank AccessionS77834X07256
GenBank GI99900058104
Gene NameIL-2ARHUIL2
Gene Length (bp)402402
SpeciesHomo sapiensEscherichia coli
StrainsNot mentionedJM101
CDSgcacctacttcaagttctacaaagaaaacacagctacaactggagcatttactgctggat
ttacagatgattttgaatggaattaataattacaagaatcccaaactcaccaggatgctc
acatttaagttttacatgcccaagaaggccacagaactgaaacatcttcagtgtctagaa
gaagaactcaaacctctggaggaagtgctaaatttagctcaaagcaaaaactttcactta
agacccagggacttaatcagcaatatcaacgtaatagttctggaactaaagggatctgaa
acaacattcatgtgtgaatatgctgatgagacagcaaccattgtagaatttctgaacaga
tggattaccttttgtcaaagcatcatctcaacactaacttga
gcacctacttctagctctaccaagaaaacccagctgcagctcgagcacctgctgctggat
ttgcagatgatcctgaacggtatcaacaattacaagaacccgaaactgacgcgtatcctg
accttcaagttctacatgccgaagaaggccaccgaactgaaacacctgcagtgtctagaa
gaagaactgaaaccgctggaggaagttctgaacctggctcagtctaaaaacttccacctg
cggccgcgtgacctgatctctaacatcaacgtaatcgttctggaactgaagggctctgaa
accaccttcatgtgtgaatacgctgatgagaccgcaaccatcgtagaattcctgaaccgt
tggatcaccttctgtcagtctatcatctctaccctgacctga
5' End
3' End
Notes
Expression VectorJM101(pNIL2-22)JM101(pNIL2-22)
Assay MethodsSDS-PAGE and ImmunoblotSDS-PAGE and Immunoblot
ResultsThe wild type gene yielded very little immunoreactive IL-2 when grown in E. coli.The recoded IL-2 gene resulted in expression up to 16 times as much as the natural gene.
Protein FunctionMediates immune response by acting as growth factor for T cells
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe recoding method included comparing amino acid codons found in the human IL-2 cDNA to codons
found in highly expressed E. coli genes. The codons were recoded to increase highly used codons in
E. coli from 43% to 85% of the total gene.
Publication Author(s)Williams, D. P.; Regier, D.; Akiyoshi, D.; Genbauffe, F.; Murphy, J. R.
Corresponding AuthorD. P. Williams
Corresponding AddressEvans Department of Clinical Research, University Hospital, Boston, MA.
Publication Year1988
Publication TitleDesign, synthesis and expression of a human interleukin-2 gene incorporating the codon usage bias found in highly expressed Escherichia coli genes
AbstractA synthetic gene encoding human interleukin-2 (IL-2) was designed such that the codon usage bias resembled that found in highly expressed Escherichia coli genes. The percentage of preferred codons was increased from 43% in the native cDNA sequence to 85% in the synthetic sequence. The cDNA and synthetic IL-2 genes were placed under the control of the trc promoter and expressed in E. coli JM101. While Northern blot analysis of IL-2 mRNA from each genetic construct demonstrated equivalent message half-lives, immunoblot and bioactivity analyses showed the synthetic gene to direct the synthesis of up to 16 times more IL-2 than the native cDNA sequence.
JournalNucleic Acids Res. 16(22): 10453-67.
SummaryThe goal of this experiment was to increase production of human interleukin-2 protein in E. coli. The wild-type gene was recoded (method of recoding was not explained) and expressed in JM101 strain E. coli. The recoded gene showed an increase in protein production of up to 16 times that of the wild type gene.
CommentsThe recoding method was not explained in the paper.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?p=664#664
PubMed ID3060845
Submitter NameBeck, Tyler
Submitter AddressUMBC, 1000 Hilltop Cr., Baltimore, Maryland 21250, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site