Synthetic Gene DataBase
 

Synthetic Gene 76


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID6876
GenBank Accession
GenBank GI
Gene NameFALVAC-1 NCOFALVAC-1 CO
Gene Length (bp)972972
SpeciesPlasmodium falciparumEscherichia coli
StrainsNot givenDH5alpha
CDSatggctaaacataaaaaattaaagcaaccaggggatggtaatccttggtccccatgtagt
gtaacttgtggaaaacctaaagacgaattagattatgaaaatgatattgaaaaaaaaatt
tgtaaaatggaaaaatgttccagtgtgtttaatgtcgtaaatagtaattctggatgtttc
agacatttagatgaaagagaagaatgtaaatgtttattagaagattcaggtagcaacgga
aagaaaatcacatgtgaatgtactaaacctgattctaagcctattgtgcaatatgacaat
ttcaatgcaaacccaaacgcaaaccccaatgcaaatcctgatggaaattgtgaagatata
ccacatgtaaatgaattttcagcaattgatcttggaaatgctgaaaaatatgataaaatg
gatgaaccacaacattatgggaaatcactcactccattagaagaattatataaaccaaat
gataaaagtttgtatcagtatataaaagcaaattctaaatttataggtataactgaacta
agcaacacattcataaacaatgctggacaacatggacatatgcatggtaacgagagggaa
gatgagagaacgcttactaaggaatatgaagatattgttttgaaagagtttacatatatg
ataaactttggaagaggacagaattattgggaacatccatatcaaaaaagtgatcaacct
aaacaatatgaacaacatttaacagattatgaaaaaattaaagaaggtaagcccttggat
aaatttggaaatatctatgattatcactatgagcattctagtccatctagtacaaagtca
tcaagtccatcaaatgtaaaatcagctagtctagctacaagattaatgaaaaaaattaaa
gctgaaatcagagatttcttcggtataagttattatgaaaaggttttagcgaaatataag
gatgatttagaa
atggctaaacacaaaaaactgaagcagccgggcgatggtaacccgtggagcccgtgtagc
gtgacctgtggcaaaccgaaagacgaactggattatgaaaacgatatcgaaaaaaaaatc
tgtaaaatggaaaaatgtagcagcgtgttcaacgtggtgaacagcaactctggctgtttc
cgtcacctggatgaacgtgaagaatgtaaatgtctgctggaagatagcggtagcaacggc
aagaaaatcacctgtgaatgtaccaaaccggatagcaagccgatcgtgcagtatgacaac
ttcaacgcaaacccgaacgcaaacccgaacgcaaacccggatggaaactgtgaagatatc
ccgcacgtaaacgaattcagcgcaatcgatctgggcaacgctgaaaaatatgataaaatg
gatgaaccgcagcactatggcaaaagcctgaccccgctggaagaactgtataaaccgaac
gataaaagcttgtatcagtatatcaaagcaaactctaaatttatcggtatcaccgaactg
agcaacaccttcatcaacaacgctggccagcacggccacatgcacggtaacgagcgtgaa
gatgagcgcaccctgaccaaggaatatgaagatatcgttctgaaagagtttacctatatg
atcaactttggccgtggccagaactattgggaacatccgtatcagaaaagcgatcagccg
aaacagtatgaacagcacctgaccgattatgaaaaaatcaaagaacgcaagccgctggat
aaatttggcaacatctatgattatcactatgagcacagcagcccgagcagcaccaagagc
agcagcccgagcaacgtaaaaagcgctagcctggctacccgtctgatgaaaaaaattaaa
gctgaaatccgtgatttcttcggtatcagctattatgaaaaggttctggcgaaatataag
gatgatctggaa
5' Endaccatggctaaacataaaaaattaaagcaaccaggggatggt
3' Endtgcggccgctcattattctaaatcatccttatatttcgctaa
NotesThe FALVAC-1 gene was previously known as CDC/NII MALVAC-1
Expression VectorNCO-pET 24DCO-pET 24d
Assay MethodsSDS-PAGE and Western BlotSDS-PAGE and Western blot
ResultsThe NCO protein was expressed only as 6% of total cell protein.The recoded gene CO produced 18% total cell protein, compared to the 6% for the natural gene.
Protein FunctionMultistage candidate vaccine against Plasmodium falciparum
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodEach of the codons were compared in CAI Application program, available at
http://bioinfo.pbi.nrc.ca/ The codon usage statistics are included in the paper.
Publication Author(s)Zhou, Z.; Schnake, P.; Xiao, L.; Lal, A. A.
Corresponding AuthorZ. Zhou
Corresponding AddressDivision of Parasitic Diseases, Centers for Disease Control and Prevention, 4770 Buford Highway, Chamblee, GA 30341, USA. zaz6@cdc.gov
Publication Year2004
Publication TitleEnhanced expression of a recombinant malaria candidate vaccine in Escherichia coli by codon optimization
AbstractThis study was conducted to compare the expression of three constructs of a multistage candidate vaccine (FALVAC-1) against Plasmodium falciparum in an Escherichia coli system: a synthetic gene with P. falciparum codons, a synthetic gene with optimized E. coli codons, and a synthetic gene with P. falciparum codons co-transformed with a RIG plasmid, which encodes three tRNAs (AG(A/G), ATA, GGA) that recognize rare E. coli codons. The expression of the protein increased at least threefold with codon optimization. The presence of the RIG plasmid in the co-transforming cells did not significantly increase the expression level of the gene with P. falciparum codons. The growth of cells transformed by the construct with P. falciparum codons was significantly slower than that of cells transformed by the construct with optimized E. coli codons after induction of protein expression with IPTG. The cells containing the non-codon optimized gene co-expressed with RIG plasmid had the slowest growth at all time points in culture. Thus, codon optimization significantly increases the yield of P. falciparum candidate vaccines in the E. coli expression system.
JournalProtein Expr Purif. 34(1): 87-94.
SummaryThe purpose of this experiment was to optimize the FALVAC-1 (previously known as CDC/NII MALVAC-1) protein to be expressed in E. coli. The gene FALVAC-1 was optimized using Backtranslation software (Entelechon GmbH), and the codon usage comparison was included in the paper. The wild type and recoded genes were then each cloned into the vector pET 24d, and inserted into DH5alpha strain E. coli. The expression rate for the natural gene was approx. 6%, and for the recoded gene, 18%.
Comments
Discussion
PubMed ID14766303
Submitter NameBeck, Tyler
Submitter AddressUMBC, 1000 Hilltop Cr., Baltimore, Maryland 21250, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site