Synthetic Gene DataBase
 

Synthetic Gene 77


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID6977
GenBank AccessionY00963
GenBank GI40479
Gene NamenanHNAN
Gene Length (bp)11491149
SpeciesClostridium perfringensNicotiana tabacum
StrainsA99leaves
CDSatgtgtaacaaaaacaatacctttgaaaagaatctagatataagccataaaccagaacca
ctaatactatttaacaaggataataacatatggaattcaaagtattttagaattcccaat
atacaattattaaatgatggtacaattttaaccttttcagatattcgttataatggtcct
gatgaccatgcttatatagacatagcttctgcacgtagtactgattttggaaagacatgg
agctataacatagcaatgaaaaataatcgtattgactctacttattctcgtgtaatggac
tccacaacagttattacaaatacaggtagaataatattaattgcaggctcatggaataca
aatggaaactgggcaatgactacttctacaagaagaagtgattggtctgtccaaatgatt
tattctgatgacaatggattaacttggtctaataaaatagatttaactaaggactcttca
aaagtaaaaaatcaaccaagtaatacaattggatggctaggaggagttggctcaggtatt
gtaatggatgatggaacaatagttatgccagcacaaatttccttaagagaaaataatgaa
aataactattattcattaattatctattcaaaggataatggtgaaacatggacaatggga
aacaaggttcctaattcaaacacctccgaaaatatggtaatagaattagatggcgcttta
attatgagtacaagatatgattactctggctatagggcagcatacatctctcatgattta
ggaaccacttgggaaatatatgaacctttaaacggtaaaattttaactggtaagggctct
ggatgccaaggttcctttattaaggctactacttcaaatggacatagaataggattaatt
tcagcacctaaaaacactaaaggtgaatatataagagacaatattgccgtttatatgatt
gactttgatgatttatctaaaggagttcaagaaatatgcattccttatcctgaagacggt
aacaaattaggtggtggctattcttgtctatcatttaaaaataaccatctaggcattgtt
tatgaagccaatggaaatatagaatatcaagacttaacaccttattactcactaattaat
aaacaataa
atgtgtaacaagaacaacaccttcgagaagaacctcgacatctcacacaagcctgaacca
cttatcctctttaacaaggataacaacatctggaattctaagtacttcaggattcctaac
atccagttgcttaatgacggtacaatccttaccttctctgacatcaggtacaacgggccc
gatgaccacgcttacattgatatcgcttctgctagatctactgaattcggtaagacctgg
tcttacaacatcgctatgaagaacaacaggatcgactcaacctactcacgtgtgatggat
tctaccactgtgatcactaacaccggccggatcattcttatcgctggatcttggaacact
aacggaaactgggctatgaccacttctaccagaaggtctgattggtctgtgcagatgatc
tactctgatgacaacggacttacttggtctaacaagatcgatctcactaaggactcttca
aaagtgaagaaccagccttctaacacaattggatggctcggaggtgttggatctggaatc
gttatggacgatggaaccatcgttatgcctgctcagatctccttaagagaaaacaacgag
aacaactactattcactcatcatatattccaaggataacggcgagacttggactatgggg
aacaaggtgccgaattccaatacgtccgagaatatggtcattgaactcgacggagcattg
atcatgtctactaggtacgattactcaggctacagagcggcatacataagtcatgacctc
gggacaacttgggaaatctacgagccacttaatggcaagattctcacaggcaaaggttcc
ggatgtcaaggatcattcatcaaagccacaacgagtaatggacatcgtattggactcatt
agtgcacctaagaacacaaaaggtgagtacattagagataatatcgccgtctacatgatc
gattttgacgatctgagcaaaggtgttcaagagatctgcattccatatccagaggatggt
aacaagctcggtggaggatactcctgtctgagttttaagaacaaccacttgggtattgtt
tacgaagctaatggtaatatcgagtatcaggacttgacaccatactatagtcttattaac
aagcagtga
5' End
3' End
NotesNo specific WT accession number and GI are given, but NCBI database accession number given is for same gene and species. No accession number or GI for recoded gene given or could be retrieved from Genbank
Expression VectorpBIB-HYG
Assay MethodsSDS-PAGESDS-PAGE, Histochemical detection
ResultsUndetectableSignificant protein expression
Protein FunctionCleaves sialic acid from glycoprotein, glycolipids, and sugars
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodons were changed from nanH based on codon usage of Arabidopsis thaliana and Nicotiana tabacum.
AATAAA, TTTGTA, and ATTTA sequences were avoided or removed. AACA Kozac consensus sequence was added
before inititation ATG codon.
Publication Author(s)Kirby, J.; Kavanagh, T. A.
Corresponding AuthorT.A. Kavanagh
Corresponding AddressDepartment of Genetics, Trinity College, Dublin 2, Ireland.
Publication Year2002
Publication TitleNAN fusions: a synthetic sialidase reporter gene as a sensitive and versatile partner for GUS
AbstractGUS continues to be the reporter of choice for many gene fusion applications, due to the unparalleled sensitivity of the encoded enzyme and the ease with which it can be quantified in cell-free extracts and visualized histochemically in cells and tissues. A compatible and functionally equivalent reporter gene would facilitate dual promoter studies and internal standardization of expression analyses in the same plant. A search for a candidate enzyme activity not found in plants, which might form the basis of a novel GUS-compatible reporter system, led us to investigate nanH, a Clostridium perfringens gene which encodes the so-called 'small' cytoplasmic sialidase. Expression of the native, AT-rich nanH gene in transgenic plants did not, however, result in detectable sialidase activity. For this reason, a codon-optimized derivative, NAN, was synthesized which possesses a GC content similar to that found in highly expressed plant genes. NAN enzyme activity was expressed at high levels in both stably and transiently transformed cells, possessed kinetic and stability properties similar to those of GUS, and showed optimal activity in GUS buffer. Moreover, NAN and GUS activity could be visualized simultaneously in polyacrylamide gels using the corresponding methylumbelliferone-based substrates, and in whole seedlings and tissue sections using the histochemical substrates 5-bromo-4-chloro-3-indolyl alpha-d-N-acetylneuraminic acid (X-NeuNAc) and 5-bromo-6-chloro-3-indolyl beta-d-glucuronide (X-GlucM), respectively.
JournalPlant J. 32(3): 391-400.
SummaryTobacco plants (Nicotiana tabacum) were transformed from a derivative of nanH, NAN, in order to increase protein production. Codons in NAN were used according to codon usage in Arabidopsis thaliana and Nicotiana tabacum. nanH transformed tobacco had no protein yields, whereas NAN had significant amount of protein yields. Overall, the recoded gene, NAN, worked well for its purpose.
CommentsNo specific WT accession number and GI are given, but NCBI database accession number given is for same gene and species. No accession number or GI for recoded gene given or could be retrieved from Genbank
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=544
PubMed ID12410816
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site