Synthetic Gene DataBase
 

Synthetic Gene 79


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID7079
GenBank Accession
GenBank GI
Gene NameL1L1h
Gene Length (bp)15961518
SpeciesHuman papillomavirusHomo sapiens
StrainsType 16NIH/3T3, TC-1
CDSatgcaggtgacttttatttacatcctagttattacatgttacgaaaacgacgtaaacgtt
taccatattttttttcagatgtctctttggctgcctagtgaggccactgtctacttgcct
cctgtcccagtatctaaggttgtaagcacggatgaatatgttgcacgcacaaacatatat
tatcatgcaggaacatccagactacttgcagttggacatccctattttcctattaaaaaa
cctaacaataacaaaatattagttcctaaagtatcaggattacaatacagggtatttaga
atacatttacctgaccccaataagtttggttttcctgacacctcattttataatccagat
acacagcggctggtttgggcctgtgtaggtgttgaggtaggtcgtggtcagccattaggt
gtgggcattagtggccatcctttattaaataaattggatgacacagaaaatgctagtgct
tatgcagcaaatgcaggtgtggataatagagaatgtatatctatggattacaaacaaaca
caattgtgtttaattggttgcaaaccacctataggggaacactggggcaaaggatcccca
tgtaccaatgttgcagtaaatccaggtgattgtccaccattagagttaataaacacagtt
attcaggatggtgatatggttcatactggctttggtgctatggactttactacattacag
gctaacaaaagtgaagttccactggatatttgtacatctatttgcaaatatccagattat
attaaaatggtgtcagaaccatatggcgacagcttatttttttatttacgaagggaacaa
atgtttgttagacatttatttaatagggctggtactgttggtgaaaatgtaccagacgat
ttatacattaaaggctctgggtctactgcaaatttagccagttcaaattattttcctaca
cctagtggttctatggttacctctgatgcccaaatattcaataaaccttattggttacaa
cgagcacagggccacaataatggcatttgttggggtaaccaactatttgttactgttgtt
gatactacacgcagtacaaatatgtcattatgtgctgccatatctacttcagaaactaca
tataaaaatactaactttaaggagtacctacgacatggggaggaatatgatttacagttt
atttttcaactgtgcaaaataaccttaactgcagacgttatgacatacatacattctatg
aattccactattttggaggactggaattttggtctacaacctcccccaggaggcacacta
gaagatacttataggtttgtaacccaggcaattgcttgtcaaaaacatacacctccagca
cctaaagaagatgatccccttaaaaaatacactttttgggaagtaaatttaaaggaaaag
ttttctgcagacctagatcagtttcctttaggacgcaaatttttactacaagcaggattg
aaggccaaaccaaaatttacattaggaaaacgaaaagctacacccaccacctcatctacc
tctacaactgctaaacgcaaaaaacgtaagctgtaa
atgagcctgtggctgcccagcgaggccaccgtgtacctgccccccgtgcccgtgagcaag
gtggtgagcaccgacgagtacgtggccaggaccaacatctactaccacgccggcaccagc
aggctgctggccgtgggccacccctacttccccatcaagaagcccaacaacaacaagatc
ctggtgcccaaggtgagcggcctgcagtacagggtgttcaggatccacctgcccgacccc
aacaagttcggcttccccgacaccagcttctacaaccccgacacccagaggctggtgtgg
gcctgcgtgggcgtggaggtgggcaggggccagcccctgggcgtgggcatcagcggccac
cccctgctgaacaagctggacgacaccgagaacgccagcgcctacgccgccaacgccggc
gtggacaacagggagtgcatcagcatggactacaagcagacccagctgtgcctgatcggc
tgcaagccccccatcggcgagcactggggcaagggcagcccctgcaccaacgtggccgtg
aaccccggcgactgcccccccctggagctgatcaacaccgtgatccaggacggcgacatg
gtggacaccggcttcggcgccatggacttcaccaccctgcaggccaacaagagcgaggtg
cccctggacatctgcaccagcatctgcaagtaccccgactacatcaagatggtgagcgag
ccctacggcgacagcctgttcttctacctgaggagggagcagatgttcgtgaggcacctg
ttcaacagggccggcgccgtgggcgagaacgtgcccgacgacctgtacatcaagggcagc
ggcagcaccgccaacctggccagcagcaactacttccccacccccagcggcagcatggtg
accagcgacgcccagatcttcaacaagccctactggctgcagagggcccagggccacaac
aacggcatctgctggggcaaccagctgttcgtgaccgtggtggacaccaccaggagcacc
aacatgagcctgtgcgccgccatcagcaccagcgagaccacctacaagaacaccaacttc
aaggagtacctgaggcacggcgaggagtacgacctgcagttcatcttccagctgtgcaag
atcaccctgaccgccgacgtgatgacctacatccacagcatgaacagcaccatcctggag
gactggaacttcggcctgcagcccccccccggcggcaccctggaggacacctacaggttc
gtgaccagccaggccatcgcctgccagaagcacaccccccccgcccccaaggaggacccc
ctgaagaagtacaccttctgggaggtgaacctgaaggagaagttcagcgccgacctggac
cagttccccctgggcaggaagttcctgctgcaggccggcctgaaggccaagcccaagttc
accctgggcaagaggaaggccacccccaccaccagcagcaccagcaccaccgccaagagg
aagaagaggaagctgtga
5' End
3' End
NotesUsed together with E7.A gene fragment , namely L1E7h, was made to use in the experiments by overlapping PCR using Pfu polymerase by combining L1h and E7h together with the addition of restriction sites .
Expression VectorL1E7pSCA1L1E7hpSCA1
Assay MethodsELISA,Western Blotting, Cytoxicity Assay, Interferon-gamma assay, T-cell proliferation Assay, Hemagglutination inhibition assay, In vivo tumor protection assay.ELISA,Western Blotting, Cytoxicity Assay, Interferon-gamma assay, T-cell proliferation Assay, Hemagglutination inhibition assay, In vivo tumor protection assay.
ResultsUndetectableSignificant increase.
Protein Functionfor preventing viral infection.
Recoding PurposeTo improve the effectiveness of the DNA plasmid.
Synthesized ByAuthors
Recoding MethodL1hpBK-CMV was used as a template for producing L1h synthetic gene.
Publication Author(s)Cheung, Y. K.; Cheng, S. C.; Sin, F. W.; Xie, Y.
Corresponding AuthorYong Xie
Corresponding AddressDepartment of Biology, The Hong Kong University of Science and Technology, Clear Water Bay, Kowloon, Hong Kong SAR, China.
Publication Year2004
Publication TitlePlasmid encoding papillomavirus Type 16 (HPV16) DNA constructed with codon optimization improved the immunogenicity against HPV infection
AbstractHuman papillomavirus Type 16 (HPV16) infections can cause neoplasia, which is thought to be closely associated with the development of cervical cancers. In the study, we attempted to construct a DNA plasmid encoding a HPV16 capsid protein (L1) and a HPV16 oncoprotein (E7), which was capable of preventing HPV16 infection and eliminating HPV16-infected cells. A plasmid, L1E7hpSCA1, encoding the L1 and E7 genes with the codon usage optimized for mammalian cell expression, was constructed. Mutations were introduced into the E7 gene sequence for reducing its oncogenicity. C57BL/6 mice were intramuscularly immunized at tibialis anterior (TA) muscles with the newly constructed L1E7hpSCA1 plasmid. The immune responses induced by the L1E7hpSCA1 plasmid (with codon optimization) and a control L1E7pSCA1 plasmid (without codon optimization) were compared. It is shown that the L1E7hpSCA1 was able to induce much stronger immune responses than the L1E7pSCA1. Sera obtained from immunized animals were found to contain anti-HPV16 antibodies as detected by ELISA and hemagglutination inhibition (HAI) assays. Cytotoxicity and interferon-gamma assays showed that spleenocytes from immunized animals were able to recognize and lyze E7 expressing tumor TC-1 cells. Moreover, the growth of E7 expressing tumor mass was inhibited in vaccinated mice. In vivo tumor protection test indicated that tumor formation was prevented in the experimental animals (67%) after vaccination with L1E7hpSCA1, while for the control group injected with L1E7pSCA1 only and the animal group injected with pSCA1 only, tumor formation was observed in all experimental animals. Our results suggest that the L1E7h gene (with codon optimization) is more effective against HPV16 than the L1E7 gene (without codon optimization). The L1E7hpSCA1 plasmid was able to provide protection against E7 expressing tumor, and it might have the potential to be a vaccine candidate for HPV prevention.
JournalVaccine. 23(5): 629-38.
SummaryTo induce higher protein expression level and to improve the immunogenicity against HPV infection, the recoded genes E7h and L1h were constructed. E7 sequence obtained from Genebank(K02718) was altered to optimized the codon usage for mammalian cells using overlapping PCR with Pfu polymerase and six primers, which can be found in the article. The codon were adapted according to the codon usage for Homo sapiens from Genebank. Mutagenesis of E7 gene was simultaneously introduced in the codons at position 24 and 26 so that the glycines became translated instead of cysteine 24 and glutamic acid 26. L1hpBK-CMV was used as a template for producing L1h synthetic gene. As expected, a DNA plasmid, L1E7hpSCA1, encoding codon-optimized HPV 16 L1 and E7 genes, elicited a higher immune response than the codon-unoptimized L1E7pSCA1.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=653
PubMed ID15542183
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site