Synthetic Gene DataBase
 

Synthetic Gene 80


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID6180
GenBank AccessionNC_001802
GenBank GI9629357
Gene Namewt p24gagoptimized p24 gag
Gene Length (bp)694694
Specieshuman immunodeficiency virus (HIV1)Mus musculus
StrainsType 1Spleen cells
CDStatagtgcagaacctccaggggcaaatggtacatcaggccatatcacctagaactttaaa
tgcatgggtaaaagtagtagaagagaaggctttcagcccagaagtaatacccatgttttc
agcattatcagaaggagccaccccacaagatttaaataccatgctaaacacagtgggggg
acatcaagcagccatgcaaatgttaaaagagaccatcaatgaggaagctgcagaatggga
tagattgcatccagtgcatgcagggcctattgcaccaggccagatgagagaaccaagggg
aagtgacatagcaggaactactagtacccttcaggaacaaataggatggatgacacataa
tccacctatcccagtaggagaaatctataaaagatggataatcctgggattaaataaaat
agtaagaatgtatagccctaccagcattctggacataagacaaggaccaaaggaaccctt
tagagactatgtagaccgattctataaaactctaagagccgagcaagcttcacaagaggt
aaaaaattggatgacagaaaccttgttggtccaaaatgcgaacccagattgtaagactat
tttaaaagcattgggaccaggagcgacactagaagaaatgatgacagcatgtcagggagt
ggggggacccggccataaagcaagagttttgtaa
gatcgtccagaacctgcagggccagatggtccaccaggccatctcgccgcgcaccctgaa
cgcctgggtcaaggtcgtcgaggagaaggccttctcgccggaggtcatcccgatgttctc
ggccctgtcggagggcgccaccccgcaggacctgaacaccatgctgaacaccgtcggcgg
ccaccaggccgccatgcagatgctgaaggagaccatcaacgaggaggccgccgagtggga
ccgcctgcacccggtccacgccggccccatcgcaccgggccagatgcgcgagcctcgcgg
ctcggacatcgccggcaccacctcgaccctccaggagcagatcggctggatgacccacaa
cccgccgatcccggtcggcgagatctacaagcgctggatcatcctgggcctgaacaagat
cgtccgcatgtactcgccgacctcgatcctggacatccgccagggtccgaaggagccgtt
ccgcgactacgtcgaccgcttctacaagaccctccgcgccgagcaggcgtcgcaggaggt
caagaactggatgaccgagaccctgctggtccagaacgccaacccggactgcaagaccat
cctgaaggccctgggtccgggcgccaccctggaggagatgatgaccgcctgccagggcgt
cggcggcccgggccacaaggcgcgagtcctgtaa
5' Endggatccggatcc
3' Endgggcccgggccc
Notes
Expression VectorpUC -hspKpUC -hspK
Assay MethodsELISA,Western blotting, lymphocyte proliferation, antigen-specific IFN-gamma ELSPOTELISA,Western blotting, lymphocyte proliferation, antigen-specific IFN-gamma ELSPOT .
ResultsUndetectablesignificant increase
Protein Function
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodon usage was optimized for expression in Mice.
Publication Author(s)Kanekiyo M, Matsuo K, Hamatake M, Hamano T, Ohsu T, Matsumoto S, Yamada T, Yamazaki S, Hasegawa A, Yamamoto N, Honda M.
Corresponding AuthorMitsuo Honda
Corresponding AddressAIDS research center,national Institute of Infectious Disease, 1-23-1 Toyama, Shinjuku, Tokyo 162-8640, Japan
Publication Year2001
Publication TitleMycobacterial codon optimization enhances antigen expression and virus-specific immune responses in recombinant Mycobacterium bovis bacille Calmette-Guerin expressing human immunodeficiency virus type 1 Gag.
AbstractAlthough its potential for vaccine development is already known, the introduction of recombinant human immunodeficiency virus (HIV) genes to Mycobacterium bovis bacille Calmette-Guerin (BCG) has thus far elicited only limited responses. In order to improve the expression levels, we optimized the codon usage of the HIV type 1 (HIV-1) p24 antigen gene of gag (p24 gag) and established a codon-optimized recombinant BCG (rBCG)-p24 Gag which expressed a 40-fold-higher level of p24 Gag than did that of nonoptimized rBCG-p24 Gag. Inoculation of mice with the codon-optimized rBCG-p24 Gag elicited effective immunity, as evidenced by virus-specific lymphocyte proliferation, gamma interferon ELISPOT cell induction, and antibody production. In contrast, inoculation of animals with the nonoptimized rBCG-p24 Gag induced only low levels of immune responses. Furthermore, a dose as small as 0.01 mg of the codon-optimized rBCG per animal proved capable of eliciting immune responses, suggesting that even low doses of a codon-optimized rBCG-based vaccine could effectively elicit HIV-1-specific immune responses.
JournalJ Virol. 2005 Jul;79(14):8716-23.. 0(): .
SummaryThe purpose of this experiment is to enhance the expression of the BCG-p 24 Gag. To do so, the mycobacterial codon usage optimization of HIV-1 gag p24 gene and construction of an rBCG encoding the codon-optimized gene by increasing the the total G+C content of the coding region were done. The codon-optimized rBCG-p24 Gag expresses significant higher level of p24 Gag than that of nonoptimized rBCG-p24 Gag. Experiments were done using female BALB/c (H-2d) mice. As expected, immunization of mice with the codon-optimized rBCG-p24 Gag elicited effective immunity even with low dose and immunitzation of animals with the nonoptimized rBCG-p24 Gag induced only low levels of immune responses.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=659
PubMed ID15994765
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site