Synthetic Gene DataBase
 

Synthetic Gene 81


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID6581
GenBank Accession
GenBank GI
Gene Namewtgagsyngag
Gene Length (bp)15391539
Specieshuman immunodeficiency virus (HIV1)Homo sapiens, Mus musculus, Monkey
StrainsType 1H1299, COS-7, C2C12
CDSatgggcgccagggccagcgtgctgagcggcggcgagctggacaggtgggagaagatcagg
ctgaggcccggcggcaagaagaagtataagctgaagcacatcgtgtgggccagcagggag
ctggagaggttcgccgtgaaccccggcctgctggagaccagcgagggctgcaggcagatc
ctgggccagctgcagcccagcctgcagaccggcagcgaggagctgaggagcctgtacaac
accgtggccaccctgtactgcgtgcaccagaggatcgagatcaaggacaccaaggaggcc
ctggacaagatcgaggaggagcagaacaagtccaagaagaaggcccagcaggccgccgcc
gacaccggccacagcagccaggtgagccagaactaccccatcgtgcagaacatccagggc
cagatggtgcaccaggccatcagccccaggaccctgaacgcctgggtgaaggtggtggag
gagaaggccttcagccccgaggtgatccccatgttcagcgccctgagcgagggagccacc
ccccaggacctgaacaccatgctgaacaccgtgggcggccaccaggccgccatgcagatg
ctgaaggagaccatcaacgaggaggccgccgagtgggacagggtgcaccccgtgcacgcc
ggccccatcgcccccggccagatgagggagccccgcggcagcgacatcgccggcaccacc
agcaccctgcaggagcagatcggctggatgaccaacaacccccccatccccgtgggcgaa
atctacaagaggtggatcatcctgggcctgaacaagatcgtgaggatgtacagccccacc
agcatcctggatatcaggcagggccccaaagagcccttcagggactacgtggacaggttc
tacaagaccctgcgcgccgagcaggccagccaggaggtgaagaactggatgaccgagacc
ctgctggtgcagaacgccaaccccgactgcaagaccatcctgaaggccctgggacccgcc
gccaccctggaggagatgatgaccgcctgccagggcgtgggcggccccggccacaaggcc
agggtgctggccgaggccatgagccaggtgaccaacaccgccaccatcatgatgcagagg
ggcaacttcaggaaccagaggaagatggtgaagtgcttcaactgcggcaaggagggccac
accgccaggaactgccgcgcccccaggaagaagggctgctggaagtgcggcaaggagggc
caccagatgaaggactgcaccgagaggcaggccaacttcctgggcaagatctggcccagc
tacaagggcaggcccggcaacttcctgcagagcaggcccgagcccaccgccccccccttc
ctgcagagcaggcccgagcccaccgccccccccgaggagagcttcaggagcggcgtggag
accaccacccccccccagaagcaggagcccatcgacaaggagctgtaccccctgaccagc
ctgaggagcctgttcggcaacgacccctcgtcacaataa
atgggtgcgagagcgtcagtattaagcgggggagaattagatcgatgggaaaaaattcgg
ttaaggccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggag
ctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaata
ctgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataat
acagtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagct
ttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagct
gacacaggacacagcagtcaggtcagccaaaattaccctatagtgcagaacatccagggg
caaatggtacatcaggccatatcacctagaactttaaatgcatgggtaaaagtagtagaa
gagaaggctttcagcccagaagtaatacccatgttttcagcattatcagaaggagccacc
ccacaagatttaaacaccatgctaaacacagtggggggacatcaagcagccatgcaaatg
ttaaaagagaccatcaatgaggaagctgcagaatgggatagagtacatccagtgcatgca
gggcctattgcaccaggccagatgagagaaccaaggggaagtgacatagcaggaactact
agtacccttcaggaacaaataggatggatgacaaataatccacctatcccagtaggacaa
atttataaaagatggataatcctgggattaaataaaatagtaagaatgtatagccctacc
agcattctggacataagacaaggaccaaaagaaccttttagagactatgtagaccggttc
tataaaactctaagagccgagcaagcttcacaggaggtaaaaaattggatgacagaaacc
ttgttggtccaaaatgcgaacccagattgtaagactattttaaaagcattgggaccagcg
gctacactagaagaaatgatgacagcatgtcagggagtaggaggacccggccataaggca
agagttttggctgaagcaatgagccaagtaacaaatacagctaccataatgatgcagaga
ggcaattttaggaaccaaagaaagatggttaagtgtttcaattgtggcaaagaagggcac
acagccagaaattgcagggcccctaggaaaaagggctgttggaaatgtggaaaggaagga
caccaaatgaaagattgtactgagagacaggctaattttttagggaagatctggccttcc
tacaagggaaggccagggaattttcttcagagcagaccagagccaacagccccaccattt
cttcagagcagaccagagccaacagccccaccagaagagagcttcaggtctggggtagag
acaacaactccccctcagaagcaggagccgatagacaaggaactgtatcctttaacttcc
ctcagatcactctttggcaacgaccccagcagccagtga
5' End
3' End
NotesThe wt type gene sequence from the article is different from the sequence from the NCBI gene bank (Acession number: NC_001802). The sequences used in this record are the same as the sequences from the article. But accession number used in this record is from NCBI
Expression VectorgagRRE, UTRgagRRENA
Assay MethodsELISA, Radioimmunoprecipitation assay, CTL assay,Immunoblotting and p24 assay.ELISA, Western blotting, Northern blotting
ResultsundetactableSignificant increase
Protein FunctionDNA binding ( GO:0003677 ), RNA binding ( GO: 0003723), RNA-directed DNA polymerase activity ( GO: 0003964)
Recoding PurposeTo improve expression and immunogenicity of DNA vaccine
Synthesized ByMarcus Graf, Alexandra Bojak, Ludwig Deml, Kurt Bi
Recoding MethodThe syngag was designed on the basic of the Pr55gag amino acid sequence employing a codon usage
occurring most frequently in highly expressed mammalian genes. By this procedure, almost every
wooble position within the wild-type coding region was changed to a G or C, resulting in a diverse
nucleotide composition and decreased AT content.
Publication Author(s)Deml, L.; Bojak, A.; Steck, S.; Graf, M.; Wild, J.; Schirmbeck, R.; Wolf, H.; Wagner, R.
Corresponding AuthorRalf Wagner
Corresponding AddressInstitute of Medical Microbiology, University of Regensburg, 93053 Regensburg, Germany.
Publication Year2001
Publication TitleMultiple effects of codon usage optimization on expression and immunogenicity of DNA candidate vaccines encoding the human immunodeficiency virus type 1 Gag protein
AbstractWe have analyzed the influence of codon usage modifications on the expression levels and immunogenicity of DNA vaccines, encoding the human immunodeficiency virus type 1 (HIV-1) group-specific antigen (Gag). In the presence of Rev, an expression vector containing the wild-type (wt) gag gene flanked by essential cis-acting sites such as the 5'-untranslated region and 3'-Rev response element supported substantial Gag protein expression and secretion in human H1299 and monkey COS-7 cells. However, only weak Gag production was observed from the murine muscle cell line C2C12. In contrast, optimization of the Gag coding sequence to that of highly expressed mammalian genes (syngag) resulted in an obvious increase in the G+C content and a Rev-independent expression and secretion of Gag in all tested mammalian cell lines, including murine C2C12 muscle cells. Mice immunized intramuscularly with the syngag plasmid showed Th1-driven humoral and cellular responses that were substantially higher than those obtained after injection of the Rev-dependent wild-type (wt) gag vector system. In contrast, intradermal immunization of both wt gag and syngag vector systems with the particle gun induced a Th2-biased antibody response and no cytotoxic T lymphocytes. Deletion analysis demonstrated that the CpG motifs generated within syngag by codon optimization do not contribute significantly to the high immunogenicity of the syngag plasmid. Moreover, low doses of coadministered stimulatory phosphorothioate oligodeoxynucleotides (ODNs) had only a weak effect on antibody production, whereas at higher doses immunostimulatory and nonstimulatory ODNs showed a dose-dependent suppression of humoral responses. These results suggest that increased Gag expression, rather than modulation of CpG-driven vector immunity, is responsible for the enhanced immunogenicity of the syngag DNA vaccine.
JournalJ Virol. 75(22): 10991-1001.
SummaryTo determine the effects of codon usage optimization on expression and immunogenicity of DNA vaccines encoding HIV1 gag protein, the recoded gene syngag from Graf2000 was used. The syngag was designed on the basic of the Pr55gag amino acid sequence employing a codon usage occurring most frequently in highly expressed mammalian genes. By this procedure, almost every wooble position within the wild-type coding region was changed to a G or C, resulting in a diverse nucleotide composition and decreased AT content. As expected, the recoded gene syngag resulted in an obvious increase in Rev-independent expression and secretion of Gag in all tested mammalian cell lines including murine C2C12 muscle cells. However, deletion analysis showed that CpG motifs genetrated within syngag by codon optimization do not contribute significantly to high immunogenicity of the syngag plasmid. Thus, conclusion can be made that increased Gag expression, rather than modulation of CpG-driven vector immunity, is responsible for the enhanced immunogenicity of the syngag DNA vaccine.
CommentsThe design of synthetic gene is described in Graf et al. 2000
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=667
PubMed ID11602739
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site