Synthetic Gene DataBase
 

Synthetic Gene 82


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID7182
GenBank AccessionAY177679AJ313181
GenBank GI2775286015212104
Gene NameL1oriL1p
Gene Length (bp)15181518
SpeciesHuman papillomavirus (HPV)Solanum tuberosum
StrainsType 16Leaves
CDSatgtctctttggctgcctagtgaggccactgtctacttgcctcctgtcccagtatctaag
gttgtaagcacggatgaatatgttgcacgcacaaacatatattatcatgcagggacatcc
agactacttgcagttggacatccctattttcctattaaaaaacctaacaataacaaaata
ttagttcctaaagtatcaggattacaatacagggtatttagaatacatttacctgacccc
aataagtttggttttcctgacacctcattttataatccagatacacagcggctggtttgg
gcctgtgtaggtgttgaggtaggccgtggtcagccattaggtgtgggcattagtggccat
cctttattaaataaattggatgacacagaaaatgctagtgcttatgcagcaaatgcaggt
gtggataatagagaatgtatatctatggattacaaacaaacacaattgtgtttaattggt
tgcaaaccacctataggggaacactggggcaaaggatccccatgtaccaatgttgcagta
aatccaggtgattgtccaccattagagttaataaacacagttattcaggatggtgatatg
gttgatactggctttggtgctatggactttactacattacaggctaacaaaagtgaagtt
ccactggatatttgtacatctatttgcaaatatccagattatattaaaatggtgtcagaa
ccatatggcgacagcttatttttttatttacggagggaacaaatgtttgttagacattta
tttaatagggctggtgctgttggtgaaaatgtaccagacgatttatacattaaaggctct
gggtctactgcaaatttagccagttcaaattattttcctacacctagtggttctatggtt
acctctgatgcccaaatattcaataaaccttattggttacaacgagcacagggccacaat
aatggcatttgttggggtaaccaactatttgttactgttgttgatactacacgcagtaca
aatatgtcattatgtgctgccatatctacttcagaaactacatataaaaatactaacttt
aaggagtacctacgacatggggaggaatatgatttacagtttatttttcaactgtgcaaa
ataaccttaactgcagacgttatgacatacatacattctatgaattccactattttggag
gactggaattttggtctacaacctcccccaggaggcacactagaagatacttataggttt
gtaacatcccaggcaattgcttgtcaaaaacatacacctccagcacctaaagaagatccc
cttaaaaaatacactttttgggaagtaaatttaaaggaaaagttttctgcagacctagat
cagtttcctttaggacgcaaatttttactacaagcaggattgaaggccaaaccaaaattt
acattaggaaaacgaaaagctacacccaccacctcatctacctctacaactgctaaacgc
aaaaaacgtaagctgtaa
atgtcactttggcttccatcagaagctactgtttaccttccaccagttccagtttcaaaa
gttgtttcaactgatgaatacgttgctaggactaatatttactaccatgctggaacttca
aggcttcttgctgttggacatccatactttccaattaaaaaaccaaataataataaaatt
cttgttccaaaagtttcaggacttcaatacagggtttttaggattcatcttccagatcca
aataaatttggatttccagatacttcattttacaatccagatactcaaaggcttgtttgg
gcttgtgttggagttgaagttggaaggggacaaccacttggagttggaatttcaggacat
ccacttcttaataaacttgatgatactgaaaatgcttcagcttacgctgctaatgctgga
gttgataatagggaatgtatttcaatggattacaaacaaactcaactttgtcttattgga
tgtaaaccaccaattggagaacattggggaaaaggatcaccatgtactaatgttgctgtt
aatccaggagattgtccaccacttgaacttattaatactgttattcaagatggagatatg
gttgatactggatttggagctatggattttactactcttcaagctaataaatcagaagtt
ccacttgatatctgtacttcaatttgtaaatacccagattacattaaaatggtttcagaa
ccatacggagattcactttttttttaccttaggagggaacaaatgtttgttaggcatctt
tttaatagggctggagctgttggagaaaatgttccagatgatctttacattaaaggatca
ggatcaactgctaatcttgcttcatcaaattactttccaactccatcaggatcaatggtt
acttcagatgctcaaatttttaataaaccatactggcttcaaagggctcaaggacataat
aatggaatttgttggggaaatcaactttttgttactgttgttgatactactaggtcaact
aatatgtcactttgtgctgctatttcaacttcagaaactacttacaaaaatactaatttt
aaagaataccttaggcatggagaagaatacgatcttcaatttatttttcaactttgtaaa
attactcttactgctgatgttatgacttacattcattcaatgaattcaactattcttgaa
gattggaattttggacttcaaccaccaccaggaggaactcttgaagatacttacaggttt
gttacttcacaagctattgcttgtcaaaaacatactccaccagctccaaaagaggatcca
cttaaaaaatacactttttgggaagttaatcttaaagaaaaattttcagcagatcttgat
caatttccacttggaaggaaatttcttcttcaagctggacttaaagctaaaccaaaattt
actcttggaaaaaggaaagctactccaactacttcatcaacttcaactactgctaaaagg
aaaaaaaggaaactttga
5' End
3' End
NotesAn accession number and actual CDS was not provided for L1ori, but supplied instead is the complete CDS and accession number of the complete HPV-16 L1 gene.
Expression VectorBin-19 derived binary vector with CaMV35s promoter regionBin-19 derived binary vector with CaMV35s promoter region
Assay MethodsWestern BlotNorthern Blot, Western Blot, ELISA
ResultsUndetectableUndetectable
Protein FunctionMajor structural protein, generates VLP (virus-like particles)
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodon usage was based on the codon usage database of Solanum tuberosum.
Publication Author(s)Biemelt, S.; Sonnewald, U.; Galmbacher, P.; Willmitzer, L.; Muller, M.
Corresponding AuthorMartin Muller
Corresponding AddressInstitut fur Pflanzengenetik und Kulturpflanzenforschung, 06466 Gatersleben, Germany.
Publication Year2003
Publication TitleProduction of human papillomavirus type 16 virus-like particles in transgenic plants
AbstractCervical cancer is linked to infection with human papillomaviruses (HPV) and is the third most common cancer among women worldwide. There is a strong demand for the development of an HPV preventive vaccine. Transgenic plants expressing the HPV major capsid protein L1 could be a system to produce virus-like particles for prophylactic vaccination or could even be used as edible vaccines to induce an L1-specific prophylactic immune response. Here, we describe the generation of transgenic tobacco and potato plants carrying the HPV type 16 major structural gene L1 under the control of the cauliflower mosaic virus 35S promoter. All attempts to express either the original, unmodified L1 gene or an L1 gene with a codon usage optimized for expression in plants failed. Surprisingly, small amounts of the protein were detected using an L1 gene optimized for expression in human cells. However, Northern blot analysis revealed that most of the L1 transcripts were degraded. Introduction of the translational enhancer Omega derived from the tobacco mosaic virus strongly increased transcript stability and resulted in accumulation of L1 protein to approximately 0.5 to 0.2% of total soluble protein in transgenic tobacco and potato plants, respectively. The plant-derived L1 protein displayed conformation-specific epitopes and assembled into virus-like particles. Furthermore, we did not find any indications of protein modification of the L1 protein produced in plants. Plant-derived L1 was as immunogenic as L1 expressed in baculovirus-infected insect cells. Feeding of tubers from transgenic potatoes to mice induced an anti-L1 antibody response in 3 out of 24 mice, although this response was only transient in two of the mice. Our data, however, indicate that an anti-L1 response was primed in about half of the 24 animals.
JournalJ Virol. 77(17): 9211-20.
SummaryPotato plants (Solanum tuberosum) were transformed with the natural gene, L1ori, and a recoded version of the L1ori gene, L1p, in order to increase protein expression of HPV-16 L1 protein. The codon composition of L1ori was changed according to the codon usage of Solanum tuberosum. Tobacco plants (Nicotiana tabacum) were transformed as well with another recoded version of the L1ori gene, L1h, in order to increase protein expression of HPV-16 L1 protein. For, L1h, the codon composition of L1ori was changed according to the codon usage of Nicotiana tabacum. L1h transformed plants yielded very little and degraded protein. Neither L1ori nor L1p transformed plants yielded detectable amount of protein. Overall, the L1p recoded gene performed poorly as did the L1h recoded gene.
CommentsAn accession number and actual CDS was not provided for L1ori, but supplied instead is the complete CDS and accession number of the complete HPV-16 L1 gene.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=541
PubMed ID12915537
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site