Synthetic Gene DataBase
 

Synthetic Gene 84


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID7284
GenBank Accession
GenBank GI
Gene Namewtgagsyngag
Gene Length (bp)15391539
Specieshuman Immunodeficiency Virus Type 1Homo sapiens
StrainsCHO, H1299, C2C12CHO, H1299, C2C12
CDSatgggcgccagggccagcgtgctgagcggcggcgagctggacaggtgggagaagatcagg
ctgaggcccggcggcaagaagaagtataagctgaagcacatcgtgtgggccagcagggag
ctggagaggttcgccgtgaaccccggcctgctggagaccagcgagggctgcaggcagatc
ctgggccagctgcagcccagcctgcagaccggcagcgaggagctgaggagcctgtacaac
accgtggccaccctgtactgcgtgcaccagaggatcgagatcaaggacaccaaggaggcc
ctggacaagatcgaggaggagcagaacaagtccaagaagaaggcccagcaggccgccgcc
gacaccggccacagcagccaggtgagccagaactaccccatcgtgcagaacatccagggc
cagatggtgcaccaggccatcagccccaggaccctgaacgcctgggtgaaggtggtggag
gagaaggccttcagccccgaggtgatccccatgttcagcgccctgagcgagggagccacc
ccccaggacctgaacaccatgctgaacaccgtgggcggccaccaggccgccatgcagatg
ctgaaggagaccatcaacgaggaggccgccgagtgggacagggtgcaccccgtgcacgcc
ggccccatcgcccccggccagatgagggagccccgcggcagcgacatcgccggcaccacc
agcaccctgcaggagcagatcggctggatgaccaacaacccccccatccccgtgggcgaa
atctacaagaggtggatcatcctgggcctgaacaagatcgtgaggatgtacagccccacc
agcatcctggatatcaggcagggccccaaagagcccttcagggactacgtggacaggttc
tacaagaccctgcgcgccgagcaggccagccaggaggtgaagaactggatgaccgagacc
ctgctggtgcagaacgccaaccccgactgcaagaccatcctgaaggccctgggacccgcc
gccaccctggaggagatgatgaccgcctgccagggcgtgggcggccccggccacaaggcc
agggtgctggccgaggccatgagccaggtgaccaacaccgccaccatcatgatgcagagg
ggcaacttcaggaaccagaggaagatggtgaagtgcttcaactgcggcaaggagggccac
accgccaggaactgccgcgcccccaggaagaagggctgctggaagtgcggcaaggagggc
caccagatgaaggactgcaccgagaggcaggccaacttcctgggcaagatctggcccagc
tacaagggcaggcccggcaacttcctgcagagcaggcccgagcccaccgccccccccttc
ctgcagagcaggcccgagcccaccgccccccccgaggagagcttcaggagcggcgtggag
accaccacccccccccagaagcaggagcccatcgacaaggagctgtaccccctgaccagc
ctgaggagcctgttcggcaacgacccctcgtcacaataa
atgggtgcgagagcgtcagtattaagcgggggagaattagatcgatgggaaaaaattcgg
ttaaggccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggag
ctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaata
ctgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataat
acagtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagct
ttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagct
gacacaggacacagcagtcaggtcagccaaaattaccctatagtgcagaacatccagggg
caaatggtacatcaggccatatcacctagaactttaaatgcatgggtaaaagtagtagaa
gagaaggctttcagcccagaagtaatacccatgttttcagcattatcagaaggagccacc
ccacaagatttaaacaccatgctaaacacagtggggggacatcaagcagccatgcaaatg
ttaaaagagaccatcaatgaggaagctgcagaatgggatagagtacatccagtgcatgca
gggcctattgcaccaggccagatgagagaaccaaggggaagtgacatagcaggaactact
agtacccttcaggaacaaataggatggatgacaaataatccacctatcccagtaggacaa
atttataaaagatggataatcctgggattaaataaaatagtaagaatgtatagccctacc
agcattctggacataagacaaggaccaaaagaaccttttagagactatgtagaccggttc
tataaaactctaagagccgagcaagcttcacaggaggtaaaaaattggatgacagaaacc
ttgttggtccaaaatgcgaacccagattgtaagactattttaaaagcattgggaccagcg
gctacactagaagaaatgatgacagcatgtcagggagtaggaggacccggccataaggca
agagttttggctgaagcaatgagccaagtaacaaatacagctaccataatgatgcagaga
ggcaattttaggaaccaaagaaagatggttaagtgtttcaattgtggcaaagaagggcac
acagccagaaattgcagggcccctaggaaaaagggctgttggaaatgtggaaaggaagga
caccaaatgaaagattgtactgagagacaggctaattttttagggaagatctggccttcc
tacaagggaaggccagggaattttcttcagagcagaccagagccaacagccccaccattt
cttcagagcagaccagagccaacagccccaccagaagagagcttcaggtctggggtagag
acaacaactccccctcagaagcaggagccgatagacaaggaactgtatcctttaacttcc
ctcagatcactctttggcaacgaccccagcagccagtga
5' End
3' End
NotesThe wt type gene sequence from the article is different from the sequence from the NCBI gene bank (Acession number: NC_001802). The sequences used in this record are the same as the sequences from the article
Expression VectorUTRwtgagRREp-syngag
Assay MethodsELISA, Immunoblotting and p24 Capture assay, ELISAPOT assay, CTL assay, Intracellular IFN-gamma Staining and FACS analysisELISA, Immunoblotting and p24 Capture assay, ELISAPOT assay, CTL assay, Intracellular IFN-gamma Staining and FACS analysis
ResultsundetectableSignificant increase in expression and humoral immune response.
Protein FunctionDNA binding ( GO:0003677 ), RNA binding ( GO: 0003723), RNA-directed DNA polymerase activity ( GO: 0003964)
Recoding PurposeTo improve expression and immunogenicity of DNA vaccine
Synthesized ByMarcus Graf, Alexandra Bojak, Ludwig Deml, Kurt Bi
Recoding MethodThe synthetic gag gene was introduced by more than 400 substitutions homogeneously distributed
throughout the complete gag gene. Almost every wobble position within the wild-type coding region
was changed to a G or C, resulting in a diverse nucleotide composition and decreased AT content
without alterations within the encoded protein.
Publication Author(s)Bojak, A.; Wild, J.; Deml, L.; Wagner, R.
Corresponding AuthorRalf Wagner
Corresponding AddressInstitute of Medical Microbiology, University of Regensburg, Germany.
Publication Year2002
Publication TitleImpact of codon usage modification on T cell immunogenicity and longevity of HIV-1 gag-specific DNA vaccines
AbstractIn this study, we analyzed the in vitro expression, potency and longevity of immune responses induced in a Balb/c mouse model by a synthetic HIV-1 GAG gene exhibiting a codon usage that was adapted to that of highly expressed mammalian genes (syngag). In contrast to a vector containing the wild-type (wt) GAG gene, the syngag construct enabled highly efficient Gag expression in both human and rodent cell lines in complete absence of Rev and Rev-responsive element. Immunization of Balb/c mice with the wt gag plasmid DNA induced only weak and inconsistent humoral immune responses. Mice vaccinated by syngag but not wt gag developed substantial and highly consistent Gag-specific antibody titers showing a clear T helper 1 polarization even with low doses of DNA. Moreover, vaccinated mice developed a strong Gag-specific cellular immune response, including cytotoxic T cells, which was not observed in wt gag-immunized animals. Both humoral and cellular immunity were efficient and lasted for more than 20 weeks. Furthermore, the induction of the humoral as well as the cellular immune response was independent of the immunization route (intramuscular or subcutaneous). These results clearly show the advantages of codon-optimized genes with respect to the expression and immunogenicity of plasmid DNA constructs, making them promising vaccine candidates for further studies.
JournalIntervirology. 45(6-Apr): 275-86.
SummaryTo determine the impact of codon usage modification on T cell immunogenicity and longevity of HIV1 gag- specific DNA vaccines, the authors used wtgag gene and recoded gene syngag. The syngag was designed on the basic of the Pr55gag amino acid sequence employing a codon usage occurring most frequently in highly expressed mammalian genes. By this procedure, almost every wooble position within the wild-type coding region was changed to a G or C, resulting in a diverse nucleotide composition and decreased AT content. The experiments were done to make comparison between the wtgag and syngag for HIV-1 gag expressions, between wt plasmid DNA and syngag plasmid DNA for homoraland cellular immune responses and longevity, and between immunization routes. As expected, experiments results showed that syngag increased HIV1 gag expression and syngag plasmid DNA induced an increase long lasting humoral and cellular immune response which were independent of the immunization route.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=668
PubMed ID12566710
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site