Synthetic Gene DataBase
 

Synthetic Gene 85


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID7385
GenBank AccessionAY858550AF277626
GenBank GI5790468712231752
Gene Nameenv (gp160)syn.gp160
Gene Length (bp)25652463
SpeciesHuman immunodeficiency virus 1 (HIV-1)Homo sapiens, Mus musculus
Strains 293, Hela-CD4, Spleen cells
CDSatgaaagtgaaggggatcaggaagaattacttttggagatggggcatcttgctccttggg
atgttaatgatctgtagtgctacagaaaatttgtgggtcacagtctattatggagtacct
gtgtggaaagaagcaaccaccactctattttgtgcatcagatgctaaagcatatgataca
gaggtacataacgtttgggccacacatgcctgtgtacccacagaccccaacccacaagaa
gtagtattgaatgtgacagaaaactttaacatgtggaaaaataacatggtagaacagatg
catgaggatataatcagtttatgggatcaaagcctacaaccatgtgtaaaattaactcca
ctctgtgttactttaaattgcgctgattatgtcaagaatgttactaatgccactagtact
aatgccactagtagcgagggaggagaaatgaaaaactgctctttcaatgtcaccacaaac
atgagagataagaagcaaaaagaatatgcacttttttataaccttgatatagtacaagta
gatgatgataatgctagtaacagctataggttgataagttgtaacacctcagtcattaca
caggcctgtccaaaggtatcctttgagccaattcccatacattattgtgccccggctggt
tttgcgattctaaagtgtaatgataagaagttcaatggaataggaccatgtataaatgtc
agcacagtacaatgtacacatggaatcaggccagtagtatctactcaactactgttaaat
ggcagtctagcagaagaagaagtagtaattagatcaaaaaatttcacgaacaatgctaac
atcataatagtacagctgaatgactctgtagaaattaattgtacaagacccaacaacaat
acaagaaaaagtataactacaggaccagggagagcattttatacaacaggagaaataata
ggagatataagacaagcacattgtaacattagtaaaagcaaatggaatgacactttaaaa
caaatagttaaaaaattgagagaacaatttaagaataaaacaatagtctttaatcattcc
tcaggaggggacccagaaattgtaatgcacagttttaattgtggaggggaatttttctat
tgtaatacaacacaactgtttaacagtacttgggatattaataatactgggaatggtact
aaagggtcaaataacactgacactatcacactcccatgcagaataaaacagattataaac
atgtggcaggaggtaggaaaagcaatgtatgcccctcccatcagaggacaaattagatgt
tcctcaaatattacaggactgatattaacaagagatgggggtaataacaatgataccaac
aatgataccgaggtcttcagacctggaggaggagatatgagagacaattggagaagtgaa
ttatataaatataaagtagtaaaaattgaacctttaggagtagcacccactaaggcaaag
agaagagtggtgcagagagaaaaaagagcagtgggaataggagccttgttccttgggttc
ttgggagcagcaggaagcactatgggcgcagcgtcaatgacgctgacggtacaggccaga
caattgttgtctggtatagtgcaacagcagaacaatttgctgaaggctattgaggcgcaa
cagcatctgttgcaactcacagtctggggcatcaaacagctccaggcaagagtcctggct
gtagaaagatacctacaggatcaacagctcctgggaatttggggttgctctggaaaactc
atctgcaccactgctgtgccttggaatgctagttggagtaataaatctctgaacgagatc
tggggtaacatgacctggatgcagtgggaaaaagaaattggcaattacacaagtttaata
tacaccttacttgaaaaatcgcaaaaccaacaagaaaagaatgaacaagagttattggaa
ttggataaatgggcaagtttgtggaattggtttgacataacaaattggctgtggtatata
aaaatattcataatgatagtaggaggcttggtaggtttaagaatagtttttactgtactt
tctatagtaaatagagttaggcagggatattcaccattatcgttccagacccgcctccca
gctccgaggggacccgacaggcccgaaggaatcgaagaagaaggtggagacagagacaga
gacagatccagtcgattagtggatggattcttagcactcatctgggaagacctgcggagc
ctgtgcctcttcagctaccaccgcttgagagacttactattgattgtaacgaggattgtg
gaacttctgggacgcagggggtgggaactcctcaaatattggtggaatcttctacagtat
tggagccaggaactaaagagcagtgctgttagtttgcttaatgccacagctatagcagta
gctgaggggacagataggattatagaaggattacaaagagcttttagagctattctcaac
atacctacaagaataagacagggcttggaaagggctttactataa
gctagcgcggccgaccgcctgtgggtgaccgtgtactacggcgtgcccgtgtggaaggac
gccaccaccaccctgttctgcgccagcgacgccaaggcctacgacaccgaggtgcacaac
gtgtgggccacccacgcgtgcgtgcccaccgaccccaacccccaggaggtggtgctgggc
aacgtgaccgagaacttcaacatgggcaagaacaacatggtggagcagatgcacgaggat
atcatcagcctgtgggaccagagcctgaagccctgcgtgaagctgacccccctgtgcgtg
accctgaactgcaccaagctgaagaacagcaccgacaccaacaacacccgctggggcacc
caggagatgaagaactgcagcttcaacatcagcaccagcgtgcgcaacaagatgaagcgc
gagtacgccctgttctacagcctggacatcgtgcccatcgacaacgacaacaccagctac
cgcctgcgcagctgcaacacatcgatcatcacccaggcctgccccaaggtgagcttcgag
cccatccccatccacttctgcgcccccgccggcttcgccatcctgaagtgcaacaacaag
accttcaacggcaccggcccctgcaccaacgtgagcaccgtgcagtgcacccacggaatt
cgccccgtggtgagcacccagctgctgctgaacggcagcctggccgaggaggaggtggtg
atcagatctgagaacttcaccaacaacgccaagaccatcatcgtgcagctgaacgagagc
gtggagatcaactgcacccgccccaacaacaacacccgcaagagcatccacatcggccct
ggccgcgccttctacaccaccggcgacatcatcggcgacatccgccaggcccactgcaac
atctctagaaccaactggaccaacaccctgaagcgcgtggccgagaagctgcgcgagaag
ttcaacaacaccaccatcgtgttcaaccagagctccggcggcgaccccgagatcgtgatg
cacagcttcaactgcggcggcgagttcttctactgcaacaccacccagctgttcaacagc
acctggaacgagaccaacagcgagggcaacatcactagtggcaccatcaccctgccctgc
cgcatcaagcagatcatcaacatgtggcaggaggtgggcaaggccatgtacgcccccccc
atcggcggccagatcaagtgcctgagcaacatcaccggcctgctgctgacccgcgacggc
ggcagcgacaactcgagcagcggcaaggagattttccgccccggcggcggcgacatgcgc
gacaactggcgcagcgagctgtacaagtacaaggtggtgaagatcgagcccctgggcatc
gcccccaccaaggccaagcgccgcgtggtgcagcgcgagaagcgcgccgtgggcatcggc
gctatgttcctcggcttcctgggcgctgcaggcagcaccatgggcgccgccagcctgacc
ctgaccgtgcaggcccgccagctgctgagcggcatcgtgcagcagcagaacaacctgctg
cgcgccatcgaggcccagcagcacctgctccagctgaccgtgtggggcatcaagcagctc
caggcccgcgtgctggctctagagcgctacctccaggaccagcgcttcctgggcatgtgg
ggctgctccggcaagctgatctgcaccacggccgtgccctggaacgccagctggagcaac
aagaacctgagccagatttgggacaacatgacctggatggagtgggagcgcgagatcagc
aactacaccgagatcatctacagcctgatcgaggagagccagaaccagcaggagaagaac
gagctggacctgctccagctggacaagtgggcaagcttgtggaactggttcaacatcacc
aactggctgtggtacatcaagattttcatcatgatcgtgggcggcctgatcggcctgcgc
atcgtgttcaccgtgctgagcatcgtgaaccgcgtgcgccagggctacagccccctgagc
ttccagacccgcctgcccgtgccccgcggccccgaccgccccgagggcatcgaggaggag
ggcggcgagcgcgaccgcgaccgcagcacccgcctggtgaccggcttcctgcccctgatc
tgggacgacctgcgcagcctgttcctgttcagctaccatcgattgcgcgacctgctgctg
atcgtggcccgcatcgtggagctgctgggccggcgcggctgggagatcctgaagtactgg
tggaacctgctccagtactggagccaggagctgaagaactctgcagtgagcctgctgaac
gccaccgccatcgccgtggccgagggcaccgaccgcgtgatcgaggtggtgcagcgcatc
tggcgcggcatcctgcacatccccacccgaattcgccagggcttcgagcgcgccctgctg
taa
5' End
3' Endggatcc
NotesHIV-1 isolate SUMA736-75 from USA envelope glycoprotein (env) gene,complete cds. May different form the sequence that the authors used.
Expression VectorNA
Assay MethodsELISAELISA
Resultspoor expressionSignificant increased.
Protein Functionenvelope protein (receptor binding and fusion)
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding Methodsubstitution of the endogenous codon triples with thoes overrepresented in mammalian high expression
gene.
Publication Author(s)Vinner, L.; Nielsen, H. V.; Bryder, K.; Corbet, S.; Nielsen, C.; Fomsgaard, A.
Corresponding AuthorAnders Fomsgaard
Corresponding AddressDepartment of Virology, Statens Serum Institut, Copenhagen, Denmark.
Publication Year1999
Publication TitleGene gun DNA vaccination with Rev-independent synthetic HIV-1 gp160 envelope gene using mammalian codons
AbstractDNA immunization with HIV envelope plasmids induce only moderate levels of specific antibodies which may in part be due to limitations in expression influenced by a species-specific and biased HIV codon usage. We compared antibody levels, Th1/Th2 type and CTL responses induced by synthetic genes encoding membrane bound gp160 versus secreted gp120 using optimized codons and the efficient gene gun immunization method. The in vitro expression of syn.gp160 as gp120 + gp41 was Rev independent and much higher than a classical wt.gp160 plasmid. Mice immunized with syn.gp160 and wt.gp160 generated low and inconsistent ELISA antibody titres whereas the secreted gp120 consistently induced faster seroconversion and higher antibody titres. Due to a higher C + G content the numbers of putative CpG immune (Th1) stimulatory motifs were highest in the synthetic gp160 gene. However, both synthetic genes induced an equally strong and more pronounced Th2 response with higher IgG1/IgG2a and IFNgamma/IL-4 ratios than the wt.gp160 gene. As for induction of CTL, synthetic genes induced a somewhat earlier response but did not offer any advantage over wild type genes at a later time point. Thus, optimizing codon usage has the advantage of rendering the structural HIV genes Rev independent. For induction of antibodies the level of expression, while important, seems less critical than optimal contact with antigen presenting cells at locations reached by the secreted gp120 protein. A proposed Th1 adjuvant effect of the higher numbers of CpG motifs in the synthetic genes was not seen using gene gun immunization which may be due to the low amount of DNA used.
JournalVaccine. 17(17): 2166-75.
SummaryTo determine "gene gun" DNA vaccination with Rev- independent synthetic HIV1 gp160 env gene using mammalian codons, comparisons were made on antibody levels, Th1/Th2 type, and CTL responses induced by synthetic gp160 and synthetic gp120. Genes were recoded by systematic substitution of the endogenous codon triplets with those overrepresented in mammalian high expression genes. Experiments were done and results showed significant increased in expression of both synthetic gp160 and gp120 compared to wild type. However, the secreted syn.gp120 consistently induced faster seroconversion and higher titres than membrane bound syn.gp160. Both synthetic genes induced more pronounced Th2 profile than the native wt.gp160. For CTL response, all three genes, wt.gp160, syn.gp160, and syn.gp120 induced equal levels.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=664
PubMed ID10367950
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site