Synthetic Gene DataBase
 

Synthetic Gene 86


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID7486
GenBank AccessionM65201
GenBank GI142274
Gene NamewtROSsynROS
Gene Length (bp)429450
SpeciesAgrobacterium tumefaciensArabidopsis thaliana, Brassica napus
StrainsLeaves
CDSatgacggaaactgcatacggtaacgcccaggatctgctggtcgaactgacggcggatatt
gtggctgcctatgttagcaaccacgtcgttccggtaactgagcttcccggccttatttcg
gatgttcatacggcactcagcggaacatcggcaccggcatcggtggcggtcaatgttgaa
aagcagaaggcccttgtgtcggttcgcaagtcggttcaggacgatcatatcgtctgtttg
gaatgtggtggcttcgtcaagtcgctcaaacgccacctgacgacgcatcacagcatgacg
ccggaagaatatcgcagaaaatgggatctgccggtcgattatccgatggttgctcccgcc
tatgccgaagcccgttcggcggctcccaaggaaatgggtctcggtcagcgccgcaaggcg
aaccgttga
atgactgagactgcttacggtaacgctcaggatcttcttgttgagcttactgctgatatc
gttgctgcttacgtttctaaccacgttgttcctgttactgagcttcctggacttatctct
gatgttcatactgcactttctggaacatctgctcctgcttctgttgctgttaacgttgag
aagcagaaggcctctgtttctgttcgtaagtctgttcaggatgatcatatcgtttgtttg
gagtgtggtggtttcttcaagtctctcaagcgtcaccttactactcatcactctatgact
ccagaggagtatagaggagaatgggatcttcctgttgattaccctatggttgctcctgct
tacgctgaggctcgttctgcgtctcctaaggagatgggtctcggtcagcgtcgtaaggct
aaccgtccaaaaaagaagcgtaaggtctga
5' End
3' End
NotesNo accession number or GI given for synROS.
Expression VectorpBI121
Assay MethodsNorthern Blot
ResultsSignificant amounts of protein (32%-87% repression via synROS in A. thaliana and 23%-76% in B. napus)
Protein Functionnegative regulator for virC and virD operons
Recoding PurposeTo improve expression
Synthesized ByPlant Biotechnology Institute (Saskatoon, Canada)
Recoding MethodCodons in wtROS were modified to fit plant translation by codon usage patterns of dicotyledonous
plants. An SV40 nuclear localization signal was inserted before the stop codon at the 3’ end.
Publication Author(s)Schafer, U. A.; Hegedus, D. D.; Bate, N. J.; Hannoufa, A.
Corresponding AuthorAbdelali Hannoufa
Corresponding AddressMolecular Genetics Section, Agriculture and Agri-Food Canada, Saskatoon Research Centre, 107 Science Place, Saskatoon, Sask., Canada S7N 0X2.
Publication Year2004
Publication TitleA ROS repressor-mediated binary regulation system for control of gene expression in transgenic plants
AbstractWe describe a novel binary system to control transgene expression in plants. The system is based on the prokaryotic repressor, ROS, from Agrobacterium tumefaciens, optimized for plant codon usage and for nuclear targeting (synROS). The ROS protein bound in vitro to double stranded DNA comprising the ROS operator sequence, as well as to single stranded ROS operator DNA sequences, in an orientation-independent manner. A synROS-GUS fusion protein was localized to the nucleus, whereas wtROS-GUS fusion remained in the cytoplasm. The ability of synROS to repress transgene expression was validated in transgenic Arabidopsis thaliana and Brassica napus. When expressed constitutively under the actin2 promoter, synROS repressed the expression of the reporter gene gusA linked to a modified CaMV35S promoter containing ROS operator sequences in the vicinity of the TATA box and downstream of the transcription initiation signal. Repression ranged from 32 to 87% in A. thaliana, and from 23 to 76% in B. napus. These results are discussed in relation to the potential application of synROS in controlling the expression of transgenes and endogenous genes in plants and other organisms.
JournalTransgenic Res. 13(2): 109-18.
SummaryArabidopsis thaliana and Brassica napus were transformed with synROS, a recoded gene of wtROS. synROS was codon optimized based on the codon usage patterns of dicotyledonous plants. Protein expression, via synROS, was high in both Arabidopsis thaliana and Brassica napus which caused repression in a target gene. In general, the recoded gene worked very well for protein expression.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=555
PubMed ID15198199
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site