Synthetic Gene DataBase
 

Synthetic Gene 87


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID7587
GenBank AccessionX96418
GenBank GI1360631
Gene Namegfpsynthetic gfp
Gene Length (bp)717717
SpeciesAequorea victoriaNicotiana tabacum
StrainsLeaf tissue
CDSatgggtaagggagaggaacttttcactggagttgtcccaatcttggttgagctcgacggt
gacgtcaatggacacaagttttccgtctcaggagagggtgaaggtgatgcaacctacgga
aagttgacccttaagttcatctgcactactggaaaactccctgttccttggccaacattg
gtgaccactttctcttacggtgttcaatgcttctcacgttacccagaccatatgaagcgt
catgactttttcaagtccgccatgcccgagggttatgtgcaagagcgtactatcttcttc
aaggacgacggaaactacaagacacgtgccgaagtcaagttcgaaggtgacaccttggtg
aacagaatcgagttgaagggtatcgatttcaaggaggacggaaacattcttggacacaag
cttgagtacaactacaactcacacaatgtgtacatcatggctgacaagcagaagaacgga
atcaaggttaacttcaaaatccgtcacaacattgaggatggaagcgttcagttggctgat
cactaccaacagaatactccaattggcgatggccctgtgcttttgccagacaaccactac
ttgtccacccaatctgccctttccaaagatcccaacgaaaagagagaccacatggtcttg
cttgagtttgtgaccgctgctggcattacccacggcatggatgagttgtacaagtaa
atgggtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggt
gatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacgga
aaacttacccttaaatttatttgcactactggaaaactacctgttccttggccaacactt
gtcaccactttctcttatggtgttcaatgcttttcaagatacccagatcatatgaaacgg
catgactttttcaagagtgccatgcccgaaggttatgtacaagaaagaactatatttttc
aaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgtt
aatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaa
ttggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatgga
atcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagac
cattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattac
ctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtcctt
cttgagtttgtaacagctgctgggattacacatggcatggatgacttatacaagtaa
5' End
3' End
NotesNo specific accession number or GI given for recoded gene.
Expression VectorpBIN35SnospBIN35Snos
Assay MethodsWestern Blot, SDS-PAGE, Southern BlotWestern Blot, SDS-PAGE, Southern Blot
ResultsVery little increase in proteinVery little increase in protein (but frequency of plants with significant amounts increased)
Protein Functionproduces green fluorescence with only a cofactor of oxygen, reporter gene
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodons were modified to the codon usage patterns of highly expressed plant genes. This caused an
increase in G+C content and, as a result, a removal of potential cryptic introns.
Publication Author(s)Rouwendal GJ, Mendes O, Wolbert EJ, Douwe de Boer A.
Corresponding AuthorGerard J.A. Rouwendal
Corresponding AddressDepartment of Plant Molecular Regulation and Quality, Agrotechnological Research Institute (ATO-DLO), Wageningen, Netherlands.
Publication Year1997
Publication TitleEnhanced expression in tobacco of the gene encoding green fluorescent protein by modification of its codon usage.
AbstractThe gene encoding green fluorescent protein (GFP) from Aequorea victoria was resynthesized to adapt its codon usage for expression in plants by increasing the frequency of codons with a C or a G in the third position from 32 to 60%. The strategy for constructing the synthetic gfp gene was based on the overlap extension PCR method using 12 long oligonucleotides as the starting material and as primers. The new gene contains 101 silent nucleotide changes compared to its wild-type counterpart used in this study. Several transgenic tobacco lines containing the wild-type gfp gene contained minute amounts of a smaller protein cross-reacting with GFP antiserum, whereas only one protein of the expected size was found in transgenics with the synthetic gfp gene. The smaller protein was probably encoded by a truncated gfp mRNA created by splicing of a 84 bp cryptic intron as detected by a reverse transcription-PCR technique. A comparison of GFP production in transgenics with the wild-type and the synthetic gfp gene under the control of the enhanced CaMV 35S promoter showed that the large-scale alterations in the gfp gene increased the frequency of high expressors in the transgenic population but hardly changed the maximum GFP concentrations.The latter phenomenon may be attributed to a reduced regeneration capacity of transformed cells with higher GFP concentrations.
JournalPlant Mol Biol.. 33(6): 989-99.
SummaryTobacco plants (Nicotiana tabacum) were transformed with a recoded version of the gfp gene, synthetic gfp, in order to increase protein expression in tobacco plants. Synthetic gfp had codons based on the codon usage patterns of highly expressed plant genes. Protein expression in both gfp and synthetic gfp was low, but synthetic gfp lead to plants with a higher frequency of protein expression. Though synthetic gfp was not a total failure, it did not perform well.
CommentsNo specific accession number or GI given for recoded gene.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=560
PubMed ID9154981
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site