Synthetic Gene DataBase
 

Synthetic Gene 89


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID7789
GenBank AccessionK01396
GenBank GI177828
Gene NameAATrAAT
Gene Length (bp)12571257
SpeciesHomo sapiensOryza sativa
Strainscallus
CDSatgccgtcttctgtctcgtggggcatcctcctgctggcaggcctgtgctgcctggtccct
gtctccctggctgaggatccccagggagatgctgcccagaagacagatacatcccaccat
gatcaggatcacccaaccttcaacaagatcacccccaacctggctgagttcgccttcagc
ctataccgccagctggcacaccagtccaacagcaccaatatcttcttctccccagtgagc
atcgctacagcctttgcaatgctctccctggggaccaaggctgacactcacgatgaaatc
ctggagggcctgaatttcaacctcacggagattccggaggctcagatccatgaaggcttc
caggaactcctccgtaccctcaaccagccagacagccagctccagctgaccaccggcaat
ggcctgttcctcagcgagggcctgaagctagtggataagtttttggaggatgttaaaaag
ttgtaccactcagaagccttcactgtcaacttcggggacaccgaagaggccaagaaacag
atcaacgattacgtggagaagggtactcaagggaaaattgtggatttggtcaaggagctt
gacagagacacagtttttgctctggtgaattacatcttctttaaaggcaaatgggagaga
ccctttgaagtcaaggacaccgaggaagaggacttccacgtggaccaggtgaccaccgtg
aaggtgcctatgatgaagcgtttaggcatgtttaacatccagcactgtaagaagctgtcc
agctgggtgctgctgatgaaatacctgggcaatgccaccgccatcttcttcctgcctgat
gaggggaaactacagcacctggaaaatgaactcacccacgatatcatcaccaagttcctg
gaaaatgaagacagaaggtctgccagcttacatttacccaaactgtccattactggaacc
tatgatctgaagagcgtcctgggtcaactgggcatcactaaggtcttcagcaatggggct
gacctctccggggtcacagaggaggcacccctgaagctctccaaggccgtgcataaggct
gtgctgaccatcgacgagaaagggactgaagctgctggggccatgtttttagaggccata
cccatgtctatcccccccgaggtcaagttcaacaaaccctttgtcttcttaatgattgaa
caaaataccaagtctcccctcttcatgggaaaagtggtgaatcccacccaaaaataa
5' End
3' End
NotesNo accession number, GI, or CDS was given for the wild type gene, but a gene with a CDS with the correct amount of base pairs and amino acids is provided instead using the references. No accession number, GI, or CDS was given for the recoded gene.
Expression VectorpAPI137 with RAmy3D promoter
Assay MethodsSouthern Blot, Porcine Elastase Inhibitory Activity assay, SDS-PAGE
ResultsSignificant increase (1microgram/mL-200microgram/mL, 20% of secreted total proteins, multiple versions of plamids yielded no significant difference)
Protein Functionserine protease inhibitor
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodons were modified to the codon usage of highly expressed rice genes (Oryza sativa). G and C were
placed into the third position of codons, increasing G+C content 11%. Methionine or Valine was
placed into position 358.
Publication Author(s)Huang, J.; Sutliff, T. D.; Wu, L.; Nandi, S.; Benge, K.; Terashima, M.; Ralston, A. H.; Drohan, W.; Huang, N.; Rodriguez, R. L.
Corresponding AuthorJianmin Huang
Corresponding AddressApplied Phytologics, Inc., 4110 North Freeway Boulevard, Sacramento, CA 95834, Department of Chemical Engineering, Osaka Prefecture University, 1-1 Gakuen-Cho, Sakai 599-8531, Japan. JHuang@APINC.com
Publication Year2001
Publication TitleExpression and purification of functional human alpha-1-Antitrypsin from cultured plant cells
AbstractHuman alpha-1-antitrypsin (AAT), the most abundant protease inhibitor found in the blood, was expressed in rice embryonic tissue suspension cell culture. This was accomplished by cloning the codon-optimized AAT gene into a vector containing the rice RAmy3D promoter and its signal sequence. The synthetic gene incorporates codons synonymous with those found in highly expressed rice genes. Approximately 1000 stable transformed calli were produced by particle bombardment mediated transformation and were screened for high AAT expression using a porcine elastase inhibitory activity assay. The band shift assay also confirmed that rice-derived AAT is functional regarding its binding capability to the elastase substrate. Time course studies were conducted to determine the optimum, postinduction expression levels from cell culture. AAT expression equivalent to 20% of the total secreted proteins was achieved, and a purification scheme was developed that yielded active AAT with purity greater than 95%. The potential applications of purified plant-derived AAT for treatments of various AAT-deficient diseases are discussed.
JournalBiotechnol Prog. 17(1): 126-33.
SummaryRice plants (Oryza sativa) were transformed with a recoded version of the Human Alpha-1-antitrypsis gene (AAT), rAAT, in order to yield a higher protein expression. rATT had its codons replaced or modified based on the codons of highly expressed rice genes. rAAT had a high yield of protein and, as a result, can be considered a successful recoded gene.
CommentsNo accession number, GI, or CDS was given for the wild type gene, but a gene with a CDS with the correct amount of base pairs and amino acids is provided instead using the references. There were no tests with the wild type gene either. No accession number, GI, or CDS was given for the recoded gene. Awaiting e-mail reply for gene sequence (sent:1-6-2006)
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=548
PubMed ID11170490
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site