Synthetic Gene DataBase
 

Synthetic Gene 9


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID99
GenBank AccessionAF324493
GenBank GI12831134
Gene Namevpuvphu
Gene Length (bp)246246
Specieshuman immunodeficiency virus (HIV1)Homo sapiens
StrainsType 1HeLa cells
CDSatgcaacctataatagtagcaatagtagcattagtagtagcaataataatagcaatagtt
gtgtggtccatagtaatcatagaatataggaaaatattaagacaaagaaaaatagacagg
ttaattgatagactaatagaaagagcagaagacagtggcaatgagagtgaaggagaagta
tcagcacttgtggagatgggggtggaaatggggcaccatgctccttgggatattgatgat
ctgtag
atggtgcccattattgtcgccattgtggccctggtggtcgccattattattgccattgtg
gtgtggagcattgtgattattgagtaccgcaagattctgcgccagcgcaagattgaccgc
ctgattgaccgcctgattgagcgcgccgaggacagcggcaacgagagcgagggcgaggtg
agcgccctggtggagatgggcgtggagatgggccaccacgccccctgggacattgacgac
ctgtag
5' End
3' End
NotesThe sequence is inferred from the method described in paper from the wild-type sequence. Not confirmed yet.
Expression VectorpNL4-3pcDNA3.1 (Invitrogen)
Assay MethodsWestern blottingWestern blotting, nuclear run-on
ResultsUndetectableSignificant increase
Protein FunctionEnhance viral particle release
Recoding PurposeTo improve expression
Synthesized ByAuthors (Asymmetric PCR)
Recoding MethodNearly full optimization. The vpu initiation codon was optimized according to the Kozak context
rules (Kozak, 1987). To this effect, the C at position +4 was changed to a G, which further required
changing the nucleotides at +5 and +6, resulting in a glutamine to valine change at amino acid
position 2. Second, a GCCGCC sequence was introduced immediately upstream of the ATG initiation
codon. In addition, each vpu codon was modified to conform with the reported codon usage of highly
expressed human genes (Kotsopoulou et al. 2000). The two valine codons at positions 6 and 13 were
not fully optimized to avoid creating additional MscI sites that would have interfered with
subsequent cloning. In these cases, the GTC codon for valine was used instead of the more common GTG
codon. The internal env initiation codon was inactivated by substituting a C for a T at position
211. Lastly, two unique restriction sites were introduced, neither of which changed the VPU amino
acid sequence: an AgeI at position 165 and an AfeI site at position 229.
Publication Author(s)Nguyen, K. L.; llano, M.; Akari, H.; Miyagi, E.; Poeschla, E. M.; Strebel, K.; Bour, S.
Corresponding AuthorStephan Bour
Corresponding AddressViral Biochemistry Section, Laboratory of Molecular Microbiology, National Institutes of Allergy Diseases, Bethesda, MD 20892, USA.
Publication Year2004
Publication TitleCodon optimization of the HIV-1 vpu and vif genes stabilizes their mRNA and allows for highly efficient Rev-independent expression
AbstractTwo HIV-1 accessory proteins, Vpu and Vif, are notoriously difficult to express autonomously in the absence of the viral Tat and Rev proteins. We examined whether the codon bias observed in the vpu and vif genes relative to highly expressed human genes contributes to the Rev dependence and low expression level outside the context of the viral genome. The entire vpu gene as well as the 5' half of the vif gene were codon optimized and the resulting open reading frames (ORFs) (vphu and hvif, respectively) were cloned in autonomous expression vectors under the transcriptional control of the CMV promoter. Codon optimization efficiently removed the expression block observed in the native genes and allowed high levels of Rev- and Tat-independent expression of Vpu and Vif. Most of the higher protein levels detected are accounted for by enhanced steady-state levels of the mRNA encoding the optimized species. Nuclear run-on experiments show for the first time that codon optimization has no effect on the rate of transcriptional initiation or elongation of the vphu mRNA. Instead, optimization of the vpu gene was found to stabilize the vphu mRNA in the nucleus and enhance its export to the cytoplasm. This was achieved by allowing the optimized mRNA to use a new CRM I-independent nuclear export pathway. This work provides a better understanding of the molecular mechanisms underlying the process of codon optimization and introduces novel tools to study the biological functions of the Vpu and Vif proteins independently of other viral proteins.
JournalVirology. 319(2): 163-75.
SummaryTwo small HIV-1 accessory genes, vpu and vif, were optimized for codon usage towards the pattern observed in highly expressed human genes. Codon optimization dramatically enhanced the expression of both genes. Interestingly, this enhancement was due to the increase of mRNA stability after codon optimization.
CommentsThe env and AgeI, AfeI sites cannot be found in the recoded gene as described in the in vphu
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=517
PubMed ID15015498
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site