Synthetic Gene DataBase
 

Synthetic Gene 91


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID7991
GenBank AccessionX03151
GenBank GI54788
Gene NameThy-1Thy-1
Gene Length (bp)4890
SpeciesMus musculusHomo sapiens
Strains293T cells
CDSatgaacccagccatcagcgtcgctctcctgctctcagtcttgcaggtgtcccgagggcag
aaggtgaccagcctgacagcctgcctggtgaaccaaaaccttcgcctggactgccgccat
gagaataacaccaaggataactccatccagcatgagttcagcctgacccgagagaagagg
aagcacgtgctctcaggcacccttgggatacccgagcacacgtaccgctcccgcgtcacc
ctctccaaccagccctatatcaaggtccttaccctagccaacttcaccaccaaggatgag
ggcgactacttttgtgagcttcaagtctcgggcgcgaatcccatgagctccaataaaagt
atcagtgtgtatagagacaagctggtcaagtgtggcggcataagcctgctggttcagaac
acatcctggatgctgctgctgctgctttccctctccctcctccaagccctggacttcatt
tctctgtga
5' End
3' End
NotesThe sequence is not provided in the articles. The above sequence is from the Genbank. Similar sequence can be seen at Genbank Accession # NM_009382.
Expression VectorCDM7
Assay Methods
Resultsexpressed approximately 100 fold more than recoded one.Approximately 100 fold less expressed than wt.
Protein Function
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe codons of a small, typically highly expressed cell-surface protein, the rat Thy-1 antigen, is
replaced with the codons most frequently used by the HIV-1 envelope protein. The resulting sequence
was then edited to remove any message destabilization motifs of the form AUUUA that had been
created, and to introduce two restriction sites. for ease of creation and manipulation of the
resulting sequence
Publication Author(s)Haas, J.; Park, E. C.; Seed, B.
Corresponding AuthorBrian Seed
Corresponding AddressDepartment of Molecular Biology, Massachusetts General Hospital, Boston, Massachusetts 02114, USA.
Publication Year1996
Publication TitleCodon usage limitation in the expression of HIV-1 envelope glycoprotein
AbstractBACKGROUND. The expression of both the env and gag gene products of human immunodeficiency virus type 1 (HIV-1) is known to be limited by cis elements in the viral RNA that impede egress from the nucleus and reduce the efficiency of translation. Identifying these elements has proven difficult, as they appear to be disseminated throughout the viral genome. RESULTS. Here, we report that selective codon usage appears to account for a substantial fraction of the inefficiency of viral protein synthesis, independent of any effect on improved nuclear export. The codon usage effect is not specific to transcripts of HIV-1 origin. Re-engineering the coding sequence of a model protein (Thy-1) with the most prevalent HIV-1 codons significantly impairs Thy-1 expression, whereas altering the coding sequence of the jellyfish green fluorescent protein gene to conform to the favored codons of highly expressed human proteins results in a substantial increase in expression efficiency. CONCLUSIONS. Codon-usage effects are a major impediment to the efficient expression of HIV-1 genes. Although mammalian genes do not show as profound a bias as do Escherichia coli genes, other proteins that are poorly expressed in mammalian cells can benefit from codon re-engineering.
JournalCurr Biol. 6(3): 315-24.
SummaryTo explore whether codon bias accounted for the poor expression of envelope glycoproteins, a synthetic gene encoding the gp120 segment of HIV1 based on the sequence of the prototype virus of the most common North American subtype, HIV-1MN. The native codons of gp120 were replaced with codon chosen to reflect more closely the codon preference of highly expressed human genes. Comparisons were made on the expression of wild-type and synthetic gp120. The synthetic gene product was expressed at a very high level compared to that of the wild-type gp120. To explore futher the importance of codon usage in envelope protein expression, synthetic rat Thy-1 gene and synthetic GFP gene of the jellyfish were constructed. The codons of wild-type Thy-1 were replaced with the codons most frequrntly used by the HIV-1 envelope protein. The synthetic GFP gene was created as the same manner as synthetic gp120. Codon replacement enhanced green fluorescent protein expression. However, HIV1 codon pattern undermine the efficiency of Thy-1 expression.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=671
PubMed ID8805248
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site