Synthetic Gene DataBase
 

Synthetic Gene 92


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID8092
GenBank AccessionAB085790
GenBank GI31076332
Gene NameHab18GEF/CD147Hab18GEF
Gene Length (bp)558558
SpeciesHomo sapiens (human)Escherichia coli
StrainsBrainJM109-DE3
CDSatggctgccggcacagtcttcactaccgtagaagaccttggctccaagatactcctcacc
tgctccttgaatgacagcgccacagaggtcacagggcaccgctggctgaaggggggcgtg
gtgctgaaggaggacgcgctgcccggccagaaaacggagttcaaggtggactccgacgac
cagtggggagagtactcctgcgtcttcctccccgagcccatgggcacggccaacatccag
ctccacgggcctcccagagtgaaggctgtgaagtcgtcagaacacatcaacgagggggag
acggccatgctggtctgcaagtcagagtccgtgccacctgtcactgactgggcctggtac
aagatcactgactctgaggacaaggccctcatgaacggctccgagagcaggttcttcgtg
agttcctcgcagggccggtcagagctacacattgagaacctgaacatggaggccgacccc
ggccagtaccggtgcaacggcaccagctccaagggctccgaccaggccatcatcacgctc
cgcgtgcgcacgcagtaa
atggcagctggtactgttttcactacggtagaagatttgggctccaagatactcctcacc
tgctccttgaatgacagcgccacagaggtcacagggcaccgctggctgaaggggggcgtg
gtgctgaaggaggacgcgctgcccggccagaaaacggagttcaaggtggactccgacgac
cagtggggagagtactcctgcgtcttcctccccgagcccatgggcacggccaacatccag
ctccacgggcctcccagagtgaaggctgtgaagtcgtcagaacacatcaacgagggggag
acggccatgctggtctgcaagtcagagtccgtgccacctgtcactgactgggcctggtac
aagatcactgactctgaggacaaggccctcatgaacggctccgagagcaggttcttcgtg
agttcctcgcagggccggtcagagctacacattgagaacctgaacatggaggccgacccc
ggccagtaccggtgcaacggcaccagctccaagggctccgaccaggccatcatcacgctc
cgcgtgcgcacgcagtaa
5' Endgcggattcatgcggaattcat
3' End
NotesThe first 63 bases (coding for signal peptide) and last ~200 bp was not included in the recombinant.The optimization of mRNA secondary structure actually also involves in replacing codons.
Expression VectorpET21a+pET21a+
Assay MethodsSDS-PAGE, indirect ELISA, Western blotSDS-PAGE, indirect ELISA, Western blot
ResultsNo expression was detectedSignificant increase in protein yields (26% of total protein)
Protein FunctionHepatoma associated antigen
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe translatio initiation region (TIR) was optimized for mRNA secondary structure only.
Publication Author(s)Zhang, S. H.; Xing, J. L.; Yao, X. Y.; Chen, Z. N.
Corresponding AuthorSihe Zhang
Corresponding AddressCell Engineering Research Center, Fourth Military Medical University, Xi' an 710032, China.
Publication Year2004
Publication Title[Non-fused expression of HAb18GEF by reducing stability of translational initiation region in mRNA]
AbstractTo express the extracellular fragement of hepatoma associated antigen HAbl8G(HAb18GEF) in E. coli efficiently in a non-fusing way, the cDNA of HAb18GEF gene was inserted into prokaryotic expression vector pET21a + . The secondary structure and codon adaptation of translational initiation region (TIR, from-30 to + 39) in mRNA of recombinant vector HAb18GEF/ pET21a + was predicted simultaneously by computer-aided design. Stable Stem-Loop structures and many low-usage codons were detected in mRNA-TIR of non-optimized recombinant HAb18GEF/pET21a + vector. The stability of mRNA-TIR in recombinant HAb18GEF/pET21a + vector was reduced with following methods: (1) optimization of secondary structure (2) optimization of codon adaptation. These optimization were realized by non-continual site-directed mutagenesis without changing any amino acid sequence in TIR. After being checked through restriction endonuclease digestion and confirmed through nucleotide sequencing, the pre-optimized and post-optimized recombinant vectors were transformed into competent E. coli JM109-DE3. The resulted recombinant clones were selected randomly and induced by IPTG at 37 degrees C. The induced production of these recombinants was analyzed by SDS-PAGE, indirect ELISA, Western blot, and cell fractionation assay. The amount of HAb18GEF mRNA was also detected by RNA dot blot between pre-optimized recombinant and post-optimized recombinant. The results revealed that recombinant non-fused vectors HAb18GEF/pET21a + were successfully constructed and optimized in the secondary structure and codon adaptation of TIR respectively. The HAb18GEF was expressed efficiently in a non-fusing way in recombinant E. coli by secondary structure optimization or codon adaptation optimization. Whereas, no expression of HAb18GEF was detected in pre-optimized recombinants. The non-fused expression products-HAb18GEF, mainly as inclusion body in E. coli, yielded highly above 29.3%. A trait of expression HAb18GEF was also detected both in intermembrane space and in culture medium due to over-expression and cell leakage. Difference in non-fused expression level of HAb18GEF between secondary structure optimization and codon adaptation optimization was negligible. No difference in amount of transcribed mRNA of HAb18GEF between the pre-optimized and the post-optimized recombinants was detected. To sum up, it's feasible to express hepatoma associated antigen HAb18GEF in a non-fusing way by reducing the stability of TIR in mRNA.
JournalSheng Wu Gong Cheng Xue Bao. 20(2): 175-80.
SummaryTwo strategies were employed to re-design the translation initiation region (TIR) to improve protein expression: 1) Codon optimization only and 2) mRNA secondary structure avoidance only. Both methods appeared to work for human CD147 gene in E. coli. However, it would be more convincing if the mRNA secondary avoidance was achieved by manipulating the upstream only and leaving the coding sequence unchanged.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=507
PubMed ID15969104
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site