Synthetic Gene DataBase
 

Synthetic Gene 97


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID8497
GenBank AccessionX83959
GenBank GI634008
Gene Namegfp (humanized)Pgfp
Gene Length (bp)717717
SpeciesAequorea victoriaAfrican Green Monkey
StrainsCos-1: kidney fibroblast cells
CDSatgagcaagggcgaggaactgttcactggcgtggtcccaattctcgtggaactggatggc
gatgtgaatgggcacaaattttctgtcagcggagagggtgaaggtgatgccacatacgga
aagctcaccctgaaattcatctgcaccactggaaagctccctgtgccatggccaacactg
gtcactaccttctcttatggcgtgcagtgcttttccagatacccagaccatatgaagcag
catgactttttcaagagcgccatgcccgagggctatgtgcaggagagaaccatctttttc
aaagatgacgggaactacaagacccgcgctgaagtcaagttcgaaggtgacaccctggtg
aatagaatcgagctgaagggcattgactttaaggaggatggaaacattctcggccacaag
ctggaatacaactataactcccacaatgtgtacatcatggccgacaagcaaaagaatggc
atcaaggtcaacttcaagatcagacacaacattgaggatggatccgtgcagctggccgac
cattatcaacagaacactccaatcggcgacggccctgtgctcctcccagacaaccattac
ctgtccacccagtctgccctgtctaaagatcccaacgaaaagagagaccacatggtcctg
ctggagtttgtgaccgctgctgggatcacacatggcatggacgagctgtacaagtga
atgagtaaaggggaagaactatttacaggggtggtgcctatactagtggaactagatggg
gatgtgaatgggcacaaattttctgtcagtggggaaggggaaggggatgcaacatatggg
aaactaacactaaaatttatatgcacaacagggaaactacctgtgccatgccaacactag
tgacaacatttagttatggggtgcaatgctttagtagatatcctgatcatatgaaacaac
atgatttttttaaaagtgcaatgcccgaggggtatgtgcaagaaagaacaatatttttta
aagatgatgggaattataaaacaagagcagaagtgaaatttgaaggggatacactagtga
atagaatagagctcaaagggatagattttaaagaagatgggaatatactagggcataaac
tagaatataattataatagtcataatgtgtatataatggcagataaacaaaaaaatggga
taaaagtgaattttaaaataatacataatatagaagatggatccgtgcaactagcagatc
attatcaacaaaatacacctataggggatgggcctgtgctactacctgataaccattatc
taagtacacaaagtgcactaagtaaagatcctaatgaaaaaagagatcatatggtgctac
tcgagtttgtgacagcagcagggataacacatgggatggatgaactatataaatga
5' End
3' End
NotesWT nucleotide sequence obtained using OCR software.Recoded nucleotide sequence edited manually. Expect human error. See original paper.
Expression VectorpCDNA3pCDNA3
Assay MethodsImmunofluorescence, Northern BlotImmunofluorescence, Northern Blot
ResultsVery high levels of expression in Cos-1 cells. This synthetic gfp gene was optimized for eukaryotic cells. mRNA levels normal (relative to GAPDH internal standard).Protein expression was significantly reduced but still visible under immunofluorescence, unlike the wild-type BPV-1 L1 and L2 genes which could hardly be visualized at all. mRNA same as wt.
Protein Functionreporter gene
Recoding PurposeTo inhibit expression (negative control)
Synthesized ByAuthors
Recoding Method156/240 codons changed to correspond to papillomavirus late gene preferred codons.
Publication Author(s)Zhou, J.; Liu, W. J.; Peng, S. W.; Sun, X. Y.; Frazer, I.
Corresponding AuthorIan Frazer
Corresponding AddressCentre for Immunology & Cancer Research, University of Queensland, Princess Alexandra Hospital, Brisbane, Queensland 4102, Australia.
Publication Year1999
Publication TitlePapillomavirus capsid protein expression level depends on the match between codon usage and tRNA availability
AbstractTranslation of mRNA encoding the L1 and L2 capsid proteins of papillomavirus (PV) is restricted in vivo to differentiated epithelial cells, although transcription of the L1 and L2 late genes occurs more widely. The codon composition of PV late genes is quite different from that of most mammalian genes. To test the possibility that PV late gene codon composition determines the efficiency of PV late gene expression in some cell types, synthetic bovine papillomavirus type 1 (BPV1) late genes were constructed with codon composition modified to resemble the typical mammalian gene. Expression of these genes from a strong promoter in Cos-1 cells was compared with expression of wild-type BPV1 late genes from the same promoter. Both unmodified and modified PV late genes were transcribed in Cos-1 cells, but only the codon-modified genes were translated. In vitro translation of wild-type but not synthetic BPV1 L1 mRNA was markedly enhanced by addition of aminoacyl-tRNAs. Codon composition thus limits BPV1 late gene translation in Cos-1 cells, and this limitation can be overcome by modification of the codon composition of the genes or by provision of excess tRNA. Replacement of codons in the green fluorescent protein (gfp) gene with those frequently used in PV late genes did not alter gfp transcription in Cos-1 cells but almost abolished translation, supporting the hypothesis that the observed differences in efficiency of translation of modified and unmodified PV capsid genes were related to codon usage rather than mRNA structure. As tRNA populations vary within and between tissues in the same eukaryotic organism, we speculate that matching of tRNA availability to codon usage may be one determinant of the restriction of expression of PV late genes to differentiated epithelium.
JournalJ Virol. 73(6): 4972-82.
SummaryAuthors worked with synthetic bovine papillomavirus type 1 (BPV-1). The L1 and L2 capsid proteins are only translated in differentiated epithelial cells. They hypothesized that codon composition of the host cell was one factor that determines expression efficiency. All codons with BPV:Mammalian usage ratios greater than 2.0 were replaced with more suitable codons and most codons with ratios greater than 1.5 were replaced (See Table 1 in paper for details). The authors modified the codon composition to resemble a typical mammalian gene. The genes were then expressed in Cos-1 cells the authors found that the wild-type gene was not translated but the recoded gene was. The increase in expression was at least 1000x for both the L1 and L2 capsid proteins. The authors also found that by adding aminoacyl-tRNAs to a mammalian in vitro environment (rabbit reticulocyte lysate), they could enhance the translation of wild-type L1 mRNA. The recoded gene did not have higher translation efficiency as codon composition was not a (severely) limiting factor. Conversely, recoding a humanized (synthetic) GFP gene to represent the viral genome significantly inhibited its expression in Cos-1 cells, further supporting that codon composition can limit expression. In general, transcription of heterologous genes was neither hindered by an alien environment nor enhanced by recoding, indicating that increased protein expression is a result of change in translation efficiency and not change in mRNA levels.
CommentsExcellent paper with multiple related experiments and a lot of material to consider.
Discussion
PubMed ID10233959
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site