Synthetic Gene DataBase
 

Synthetic Gene 98


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID8598
GenBank AccessionM60856
GenBank GI208154
Gene NamecryIA(b)FScryIA(b)
Gene Length (bp)18451845
SpeciesBacillus thuringiensisLycopersicon esculentum, Nicotiana tabacum
StrainskurstakiLeaves
CDSatggataacaatccgaacatcaatgaatgcattccttataattgtttaagtaaccctgaa
gtagaagtattaggtggagaaagaatagaaactggttacaccccaatcgatatttccttg
tcgctaacgcaatttcttttgagtgaatttgttcccggtgctggatttgtgttaggacta
gttgatataatatggggaatttttggtccctctcaatgggacgcatttcttgtacaaatt
gaacagttaattaaccaaagaatagaagaattcgctaggaaccaagccatttctagatta
gaaggactaagcaatctttatcaaatttacgcagaatcttttagagagtgggaagcagat
cctactaatccagcattaagagaagagatgcgtattcaattcaatgacatgaacagtgcc
cttacaaccgctattcctctttttgcagttcaaaattatcaagttcctcttttatcagta
tatgttcaagctgcaaatttacatttatcagttttgagagatgtttcagtgtttggacaa
aggtggggatttgatgccgcgactatcaatagtcgttataatgatttaactaggcttatt
ggcaactatacagatcatgctgtacgctggtacaatacgggattagagcgtgtatgggga
ccggattctagagattggataagatataatcaatttagaagagaattaacactaactgta
ttagatatcgtttctctatttccgaactatgatagtagaacgtatccaattcgaacagtt
tcccaattaacaagagaaatttatacaaacccagtattagaaaattttgatggtagtttt
cgaggctcggctcagggcatagaaggaagtattaggagtccacatttgatggatatactt
aatagtataaccatctatacggatgctcatagaggagaatattattggtcagggcatcaa
ataatggcttctcctgtagggttttcggggccagaattcacttttccgctatatggaact
atgggaaatgcagctccacaacaacgtattgttgctcaactaggtcagggcgtgtataga
acattatcgtccaccttatatagaagaccttttaatatagggataaataatcaacaacta
tctgttcttgacgggacagaatttgcttatggaacctcctcaaatttgccatccgctgta
tacagaaaaagcggaacggtagattcgctggatgaaataccgccacagaataacaacgtg
ccacctaggcaaggatttagtcatcgattaagccatgtttcaatgtttcgttcaggcttt
agtaatagtagtgtaagtataataagagctcctatgttctcttggatacatcgtagtgct
gaatttaataatataattccttcatcacaaattacacaaatacctttaacaaaatctact
aatcttggctctggaacttctgtcgttaaaggaccaggatttacaggaggagatattctt
cgaagaacttcacctggccagatttcaaccttaagagtaaatattactgcaccattatca
caaagatatcgggtaagaattcgctacgcttctaccacaaatttacaattccatacatca
attgacggaagacctattaatcaggggaatttttcagcaactatgagtagtgggagtaat
ttacagtccggaagctttaggactgtaggttttactactccgtttaacttttcaaatgga
tcaagtgtatttacgttaagtgctcatgtcttcaattcaggcaatgaagtttatatagat
cgaattgaatttgttccggcagaagtaacctttgaggcagaatat
atggacaacaacccaaacatcaacgaatgcattccatacaactgcttgagtaacccagaa
gttgaagtacttggtggagaacgcattgaaaccggttacactcccatcgacatctccttg
tccttgacacagtttctgctcagcgagttcgtgccaggtgctgggttcgttctcggacta
gttgacatcatctggggtatctttggtccatctcaatgggatgcattcctggtgcaaatt
gaacagttaattaaccagaggatcgaagagttcgccaggaaccaggccatctctaggttg
gaaggattgagcaatctctaccaaatctatgcagagagcttcagagagtgggaagccgat
cctactaacccagctctccgcgaggaaatgcgtattcaattcaacgacatgaacagcgcc
ttgaccacagctatcccattgttcgcagtccagaactaccaagttcctctcttgtccgtg
tacgttcaagcagctaatcttcacctcagcgtgcttcgagacgttagcgtgtttgggcaa
aggtggggattcgatgctgcaaccatcaatagccgttacaacgaccttactaggctgatt
ggaaactacaccgaccacgctgttcgttggtacaacactggcttggagcgtgtctggggt
cctgattctagagattggattagatacaaccagttcaggagagaattgaccctcacagtt
ttggacattgtgtctctcttcccgaactatgactccagaacctaccctatccgtacagtg
tcccaacttaccagagaaatctatactaacccagttcttgagaacttcgacggtagcttc
cgtggttctgcccaaggtatcgaaggctccatcaggagcccacacttgatggacatcttg
aacagcataactatctacaccgatgctcacagaggagagtattactggtctggacaccag
atcatggcctctccagttggattcagcgggcccgagtttacctttcctctctatggaact
atgggaaacgccgctccacaacaacgtatcgttgctcaactaggtcagggtgtctacaga
accttgtcttccaccttgtacagaagacccttcaatatcggtatcaacaaccagcaactt
tccgttcttgacggaacagagttcgcctatggaacctcttctaacttgccatccgctgtt
tacagaaagagcggaaccgttgattccttggacgaaatcccaccacagaacaacaatgtg
ccacccaggcaaggattctcccacaggttgagccacgtgtccatgttccgttccggattc
agcaacagttccgtgagcatcatcagagctcctatgttctcatggattcatcgtagtgct
gagttcaacaatatcattccttcctctcaaatcacccaaatcccattgaccaagtctact
aaccttggatctggaacttctgtcgtgaaaggaccaggcttcacaggaggtgatattctt
agaagaacttctcctggccagattagcaccctcagagttaacatcactgcaccactttca
caaagatatcgtgtcaggattcgttacgcatctaccactaacttgcaattccacacctcc
atcgacggaaggcctatcaatcagggtaacttctccgcaaccatgtcaagcggcagcaac
ttgcaatccggcagcttcagaaccgtcggtttcactactcctttcaacttctctaacgga
tcaagcgttttcacccttagcgctcatgtgttcaattctggcaatgaagtgtacattgac
cgtattgagtttgtgcctgccgaagttaccttcgaggctgagtac
5' End
3' End
NotesTruncated, 5’ end only given for wild type gene as well. This is reason for lack of stop codon. Protein expressed as a truncated form as well.Only 5’ end, truncated version of CDS of the recoded gene is given from article as well as from NBCI.
Expression VectorpMON5383pMON5383
Assay MethodsWestern blot, ELISAWestern blot, ELISA
ResultsBarley detectable in tomato, not detectable in tobaccoHigh increase (almost 100 fold more)
Protein FunctionInsect control in crops
Recoding PurposeTo improve expression
Synthesized ByBritish Biotechnology (Oxford, U.K.)
Recoding MethodCodons were changed or replaced based on preferred tomato and tobacco plant codons. ATTTA sequences
and plant polyadenylylation sequences were removed making for a higher G+C content.
Publication Author(s)Perlak, F. J.; Fuchs, R. L.; Dean, D. A.; McPherson, S. L.; Fischhoff, D. A.
Corresponding AuthorFrederick J. Perlak
Corresponding AddressPlant Sciences, Monsanto Company, Chesterfield, MO 63198.
Publication Year1991
Publication TitleModification of the coding sequence enhances plant expression of insect control protein genes
AbstractIncreased expression of the insect control protein genes of Bacillus thuringiensis in plants has been critical to the development of genetically improved plants with agronomically acceptable levels of insect resistance. The expression of the cryIA(b) gene was compared to partially modified (3% nucleotide difference) and to fully modified (21% nucleotide difference) cryIA(b) and cryIA(c) genes in tobacco and tomato. The modified genes increased the frequency of plants that produced the proteins at quantities sufficient to control insects and dramatically increased the levels of these proteins. Among the most highly expressing transformed plants for each gene, the plants with the partially modified cryIA(b) gene had a 10-fold higher level of insect control protein and plants with the fully modified cryIA(b) had a 100-fold higher level of CryIA(b) protein compared with the wild-type gene. Similar results were obtained with the fully modified cryIA(c) gene in plants. Specific sequences of the partially modified cryIA(b) gene were analyzed for their ability to affect cryIA(b) gene expression in tobacco. The DNA sequence of a single region was identified as important to the improvement of plant expression of the cryIA(b) gene. The increased levels of cryIA(b) mRNA were not directly proportional to the increased levels of CryIA(b) protein in plants transformed with the modified cryIA(b) genes, indicating that the nucleotide sequence of these genes had an effect in improving their translational efficiency in plants.
JournalProc Natl Acad Sci U S A. 88(8): 3324-8.
SummaryTomato plants (Lycopersicon esculentum) and tobacco plants (Nicotiana tabacum) were transformed with FS cryIA(b), a recoded version of the cryIA(b) gene, in order to increase the expression of the protein, CryIA(b). The codons of cryIA(b) were changed based on the codon usage of tomato and tobacco plants. cryIA(b), the wild type gene yielded almost insignificant amounts in tomato plants and undetectable amounts in tobacco whereas FScryIA(b) yielded a much higher amount in tobacco and tomato plants. Overall, the recoded gene served its purpose and was very successful.
CommentsOnly 5’ end, truncated version of CDS of the recoded gene is given from article as well as from NBCI. Truncated, 5’ end only given for wild type gene as well.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=538
PubMed ID2014252
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site