Synthetic Gene DataBase
 

Synthetic Gene 99


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID8699
GenBank AccessionZ25483
GenBank GI410505
Gene NameCOEsynthetic COE
Gene Length (bp)426447
SpeciesPorcine Epidemic diarrhea virus (PEDV)Nicotiana tabacum
StrainsBr1/87Upper leaves
CDSatggttactttgccatcatttaatgatcattcttttgttaatattactgtctctgcggct
tttggtggtcttagtagtgccaatctcgttgcatctgacactactatcaatgggtttagt
tctttctgtgttgacactagacaatttaccattacactgttttataatgttacaaacagt
tatggttatgtgtctaaatcacaggatagtaattgtcctttcaccttgcaatctgttaat
gattacctgtcttttagcaaattttgtgtttcaaccagccttttggctggtgcttgtacc
atagatctttttggttaccctgcgttcggtagtggtgttaagttgacgtccctttatttt
caattcacaaaaggtgagttgattactggcacgcctaaaccacttgaaggtatcacagac
gtttaa
atggttactttgccatccttcaacgatcattccttcgttaatattactgtctctgctgct
ttcggaggactcagcagcgctaacctcgttgcttccgatactactatcaacggattcagc
tccttctgcgtggatactaggcaattcaccattacactcttctacaacgttacaaacagc
tacggatacgtgtccaagtcccaggatagcaactgcccattcaccttgcaatccgttaac
gattacctctccttcagcaagttctgcgtttccaccagcctcttggctggagcttgcacc
atcgatctcttcggatacccagctttcggaagcggagttaagttgacctccctctacttc
caattcacaaagggagagttgattactggaaccccaaagccactcgagggaatcacagat
gtttactctgagaaagatgagctatga
5' End
3' End
NotesThe actual protein sequence was found to be in a spike protein gene (accession number: Z25483) in the 1495-1914bp region. This number is given for the wild type gene accession and GI.No accession number or GI given for the recoded gene
Expression VectorTMV-30BTMV-30B
Assay MethodsSDS-PAGE, Western Blot, ELISASDS-PAGE, Western Blot, ELISA
ResultsVery little expression (.15% proteinHigh increase (5% protein, 30 fold more protein)
Protein Functionepitope which induces PEDV antibodies
Recoding PurposeTo improve expression
Synthesized ByGenotech (Korea)
Recoding MethodCodons from the wild type gene were removed and/or modified based on the highly expressed codon
usage patterns of tobacco. ATTTA sequences were modified and codons with a CG in the second and
third position and a TA in the same positions were avoided, which increased G+C content. And a
SEKDEL sequence was added before the stop codon.
Publication Author(s)Kang, T. J.; Kang, K. H.; Kim, J. A.; Kwon, T. H.; Jang, Y. S.; Yang, M. S.
Corresponding AuthorMoon-Sik Yang
Corresponding AddressInstitute of Basic Science, Chonbuk National University, Jeonju 561-756, Republic of Korea.
Publication Year2004
Publication TitleHigh-level expression of the neutralizing epitope of porcine epidemic diarrhea virus by a tobacco mosaic virus-based vector
AbstractPorcine epidemic diarrhea virus (PEDV) causes acute enteritis in pigs of all ages and is often fatal for neonates. A tobacco mosaic virus (TMV)-based vector was utilized for the expression of a core neutralizing epitope of PEDV (COE) for the development of a plant-based vaccine. In this study, the coding sequence of a COE gene was optimized based on the modification of codon usage in tobacco plant genes and the removal of mRNA-destabilizing sequences. The native and synthetic COE genes were cloned into TMV-based vectors and expressed in tobacco plants. The recombinant COE protein constituted up to 5.0% of the total soluble protein in the leaves of tobacco plants infected with the TMV-based vector containing synthetic COE gene, which was approximately 30-fold higher than that in tobacco plants infected with TMV-based vector containing a native COE gene. Therefore, this result indicates that the plant viral expression system with a synthetic gene optimized for plant expression is suitable to produce a large amount of antigen for the development of plant-based vaccine rapidly.
JournalProtein Expr Purif. 38(1): 129-35.
SummaryTobacco plants (Nicotiana tabacum) were transformed with a recoded version of the COE gene, synthetic COE, in order to increase the expression of COE protein. Codons in native COE were modified to fit the codon usage patterns of tobacco plants. Synthetic COE produced a much higher yield of protein than the native gene, this would lead to the conclusion that the recoded gene was very successful in its purpose.
CommentsThe actual protein sequence was found to be in a spike protein gene (accession number: Z25483) in the 1495-1914bp region. This number is given for the wild type gene accession and GI. No accession number or GI given for the recoded gene
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=559
PubMed ID15477091
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site